Entry information : MtPrx42 (Medtr5g016010.1[4.0] / Medtr2g089750.1[3.5] / Medtr5g015990.1[3.0])
Entry ID 366
Creation 2006-06-22 (Christophe Dunand)
Last sequence changes 2010-09-15 (Haythem Mhadhbi)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx42 (Medtr5g016010.1[4.0] / Medtr2g089750.1[3.5] / Medtr5g015990.1[3.0])
Name (synonym) MtPrx42 (Medtr5g016010.1[4.0] / Medtr2g089750.1[3.5] / Medtr5g015990.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Seedlings
Seeds
Stems
Inducers Glomus intraradices infection
Pathogen interaction
Phosphate starvation
Phytophthora infection
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx42
start..stop
S start..stop
MsPrx16 650 0 4..328 1..325
GmPrx25 586 0 1..328 1..328
GmPrx104 581 0 1..328 1..328
TrPrx02 505 0 5..328 6..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5654297..5654512 216 N° 2 5653994..5654194 201 N° 3 5653558..5653723 166 N° 4 5652200..5652603 404
complement(join(5652200..5652603,5653558..5653723,5653994..5654194,5654297..5654 512))


exon

Literature and cross-references MtPrx42 (Medtr5g016010.1[4.0] / Medtr2g089750.1[3.5] / Medtr5g015990.1[3.0])
Literature Journet,E.P.et al., unpublished
Protein ref. UniProtKB:   Q1SC11
DNA ref. Phytozome 12:   chr5 (5654512..5652200)
Cluster/Prediction ref. Phytozome Gene 12:   31090457
Omic ref. Gene atlas:   Mtr.37626.1.S1_at Legoo:   Mtr.37626.1.S1_at
Protein sequence: MtPrx42 (Medtr5g016010.1[4.0] / Medtr2g089750.1[3.5] / Medtr5g015990.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   36083.33 (33253.7)  
PI (pH):   %s   9.09 (8.91) Peptide Signal:   %s   cut: 26 range:26-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQLNLILVSLLFLTLFLHSRPTHAQLSRHHYKNSCPNVENIVREAVKKKFHQTFTTVPATLRLFFHDCFVQGCDGSILVSSTPHNRAERDHPDNLSLAGDGFDTVIQAKAAVDAVPLCQNKVSCADILAMATRDVIALAGGPYYEVELGRFDGLRSKDSDVNGKLPEPGFNLNQLNTLFKHHGLTQTEMIALSGAHTVGFSHCNKFTNRVYNFKTTSRVDPTLDLKYAAQLKSMCPRNVDPRVAVDMDPVTPHAFDNVYFKNLQKGKGLFTSDQVLFTDSRSKAAVNAFASSNKIFHANFVAAMTKLGRVGVKNSHNGNIRTDCSVI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 25 ESTs. (other accession CT573053).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAGCTTAATCTTATACTTGTCTCGTTACTCTTCTTAACTCTCTTTCTTCATTCACGTCCTACTCATGCCCAATTAAGTAGACACCACTACAAGAATTCTTGTCCCAATGTTGAA
AACATTGTCAGAGAAGCTGTCAAAAAGAAATTTCATCAAACATTTACAACAGTTCCTGCCACTCTACGTCTCTTCTTCCATGACTGCTTTGTTCAG
GTAATTAATTTCAATTACATGCAT
TTTATTTGGTTCACCATAAATAAATGTTACCTTTTCTAATTTATGTTGTGCATGTCTATCATATTGCAATTACCACAGGGTTGTGATGGTTCTATTCTTGTATCTTCAACGCCACATAAT
AGAGCAGAGAGGGATCACCCTGATAATCTTTCATTGGCTGGAGATGGATTTGACACAGTTATACAAGCCAAAGCAGCTGTGGACGCTGTTCCTCTTTGCCAGAATAAAGTTTCTTGTGCT
GATATTCTTGCTATGGCAACTCGTGATGTTATTGCGTTG
GTTTGTTTGTTTCTAAATTTATTCTAGAATTAATCTATTTTTTCTCTAAACTAATTTTGTTCTAAATATATAAAATTCGTC
AATTTAATCTCAACTATTAAGATGTTAGAGACTACTGCAACACATTTTCAAATATTTTAAAAGCTACATCGACGGGTTTTATATACTTTAATTATTATTAGAATATAAAAGATTTATTGT
ATAAATTATTAGACTTGGTATTATTTATGACGACTGACTAGGAGGTTAATGTAAAATTTGAATTTTCAGGCAGGAGGACCTTACTATGAGGTAGAATTGGGAAGATTTGATGGGCTAAGA
TCTAAAGATTCTGATGTTAATGGAAAACTTCCTGAGCCTGGATTCAACTTGAACCAGCTTAATACATTGTTTAAACACCACGGGCTTACACAAACAGAAATGATTGCACTTTCAG
GTAAT
GCGCCGCGTGGTTTACAGTTTTTACACTTTCCAATTAAAGGGTGCCAGTCAAATAATTTTAAACAGGTGCCATGCCAACATGAGACATATTGATCCATGTTCGGATGTTCCTATGTGATT
GTCATTATACTGTTTGAGGGTACGAGGGTATTGGATAGAATAAAATACCAAATTCGTCCATAACTTTGATGTTCACAAATAGGTCTAACATATTGTGAACATTAATAAAAAAATATCAGA
CTTTATTGAAGTTTTTTCTTATTAAACCTTCTTTGAGCATGGTAGCTACTAAATTGATATTAAGTCAAAATATTGGAAGTGGATTATAAATATAAAAAGTAGATTGATAGTAAGTTGTTA
AAATGTAGAGATTTAATTGATAGTTAATAATTAAATATAATGAGCAACTTGTCATTTTATATATTTATTTTTAGTGTCATACAAAATCTTAGACTAATTAAATGATTTAGTGGGAGGAAT
ATACAATGCAAAATAATCTTTGAAAAGTATCCTTGAGTCTTTGTGGAATTCAAATGAGCGGTAAATTCTCCTTAAAAAGTTTCATGATGCTGCATGCATAAAACTGATTTCGAACCAATG
ACTTTGGTTAAGTTAAAAGAAATGTGTATCATCTCATCTAAACGCTCTTGAATTGACTAAAAATGCACTATATAAACTCGATTATTAGCCTATATATACTACAAATTAAAGTAATTATAC
TCAAGTATCTGAGTTAGATCTTATGAGTTTTTTCAACTTAATCAATGTAGAAAAATAAAGATATCGAAGGAGATAGTATTTCTAGTGATTGTCGGCAACATATCCAATTTATAAATGTAA
AATAATAAAAAGTAATCATCTTTGAAAAGTTGAAAAGGATCATTGAATAAAATTAATAAATAAAACTTTGGATCCTTGTGTTGATTGACATGATTCATTCCCTCTGTAGGTGCTCACACT
GTTGGATTCTCACATTGCAACAAATTCACCAATAGAGTGTATAATTTCAAGACAACGAGTCGAGTAGACCCTACATTAGACTTAAAATACGCAGCACAGTTAAAATCAATGTGCCCAAGG
AATGTGGATCCAAGGGTTGCAGTTGATATGGACCCAGTTACTCCACATGCTTTCGATAATGTCTATTTCAAGAATCTACAAAAGGGGAAGGGTTTATTCACCTCAGACCAAGTCCTCTTC
ACGGATTCAAGATCCAAAGCTGCAGTAAATGCTTTTGCTAGTAGTAACAAAATATTTCATGCTAATTTTGTTGCTGCCATGACCAAATTGGGTCGAGTTGGTGTCAAGAATTCACACAAT
GGGAACATTCGTACGGATTGTTCTGTGATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAGCTTAATCTTATACTTGTCTCGTTACTCTTCTTAACTCTCTTTCTTCATTCACGTCCTACTCATGCCCAATTAAGTAGACACCACTACAAGAATTCTTGTCCCAATGTTGAA
AACATTGTCAGAGAAGCTGTCAAAAAGAAATTTCATCAAACATTTACAACAGTTCCTGCCACTCTACGTCTCTTCTTCCATGACTGCTTTGTTCAG
GGTTGTGATGGTTCTATTCTTGTA
TCTTCAACGCCACATAATAGAGCAGAGAGGGATCACCCTGATAATCTTTCATTGGCTGGAGATGGATTTGACACAGTTATACAAGCCAAAGCAGCTGTGGACGCTGTTCCTCTTTGCCAG
AATAAAGTTTCTTGTGCTGATATTCTTGCTATGGCAACTCGTGATGTTATTGCGTTG
GCAGGAGGACCTTACTATGAGGTAGAATTGGGAAGATTTGATGGGCTAAGATCTAAAGATTCT
GATGTTAATGGAAAACTTCCTGAGCCTGGATTCAACTTGAACCAGCTTAATACATTGTTTAAACACCACGGGCTTACACAAACAGAAATGATTGCACTTTCAG
GTGCTCACACTGTTGGA
TTCTCACATTGCAACAAATTCACCAATAGAGTGTATAATTTCAAGACAACGAGTCGAGTAGACCCTACATTAGACTTAAAATACGCAGCACAGTTAAAATCAATGTGCCCAAGGAATGTG
GATCCAAGGGTTGCAGTTGATATGGACCCAGTTACTCCACATGCTTTCGATAATGTCTATTTCAAGAATCTACAAAAGGGGAAGGGTTTATTCACCTCAGACCAAGTCCTCTTCACGGAT
TCAAGATCCAAAGCTGCAGTAAATGCTTTTGCTAGTAGTAACAAAATATTTCATGCTAATTTTGTTGCTGCCATGACCAAATTGGGTCGAGTTGGTGTCAAGAATTCACACAATGGGAAC
ATTCGTACGGATTGTTCTGTGATTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGGCCGGGGA CTCCTTTACT TTACCTCTGC AAAAAAACAT CAAATGGCTC AGCTTAATCT TATACTTGTC TCGTTACTCT TCTTAACTCT CTTTCTTCAT TCACGTCCTA CTCATGCCCA  ATTAAGTAGA CACCACTACA AGAATTCTTG TCCCAATGTT GAAAACATTG TCAGAGAAGC TGTCAAAAAG AAATTTCATC AAACATTTAC AACAGTTCCT GCCACTCTAC GTCTCTTCTT  CCATGACTGC TTTGTTCAGG GTTGTGATGG TTCTATTCTT GTATCTTCAA CGCCACATAA TAGAGCAGAG AGGGATCACC CTGATAATCT TTCATTGGCT GGAGATGGAT TTGACACAGT  TATACAAGCC AAAGCAGCTG TGGACGCTGT TCCTCTTTGC CAGAATAAAG TTTCTTGTGC TGATATTCTT GCTATGGCAA CTCGTGATGT TATTGCGTTG GCAGGAGGAC CTTACTATGA  GGTAGAATTG GGAAGATTTG ATGGGCTAAG ATCTAAAGAT TCTGATGTTA ATGGAAAACT TCCTGAGCCT GGATTCAACT TGAACCAGCT TAATACATTG TTTAAACACC ACGGGCTTAC  ACAAACAGAA ATGATTGCAC TTTCAGGTGC TCACACTGTT GGATTCTCAC ATTGCAACAA ATTCACCAAT AGAGTGTATA ATTTCAAGAC AACGAGTCGA GTAGACCCTA CATTAGACTT  AAAATACGCA GCACAGTTAA AATCAATGTG CCCAAGGAAT GTGGATCCAA GGGTTGCAGT TGATATGGAC CCAGTTACTC CACATGCTTT CGATAATGTC TATTTCAAGA ATCTACAAAA  GGGGAAGGGT TTATTCACCT CAGACCAAGT CCTCTTCACG GATTCAAGAT CCAAAGCTGC AGTAAATGCT TTTGCTAGTA GTAACAAAAT ATTTCATGCT AATTTTGTTG CTGCCATGAC  CAAATTGGGT CGAGTTGGTG TCAAGAATTC ACACAATGGG AACATTCGTA CGGATTGTTC TGTGATTTAA TTCATATCAA ATTGGAATGT TGTGGTCCTT GTGGATGACA AATTATCTTA 
TTGGAATGCA TTTCATGTAT ATTTATCTCC TGTTTTGCAT AAAATAATAA GAACATTATG TTCCAAAAGT ACATCTAAAA GACTACAATA ACATTTGATA CGCTGCTGAT 

Retrieve as FASTA