Entry information : MtPrx52 (Medtr5g017850.1[4.0] / Medtr5g017850.1[3.5] / Medtr5g017850.1[3.0])
Entry ID 375
Creation 2006-02-17 (Christophe Dunand)
Last sequence changes 2006-02-17 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx52 (Medtr5g017850.1[4.0] / Medtr5g017850.1[3.5] / Medtr5g017850.1[3.0])
Name (synonym) MtPrx52 (Medtr5g017850.1[4.0] / Medtr5g017850.1[3.5] / Medtr5g017850.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Mycorrhizal roots
Inducers Aphanomyces euteiches infection
Glomus intraradices infection
Mycorrhiza
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx52
start..stop
S start..stop
MtPrx58 633 0 1..326 1..326
LjPrx36 582 0 1..326 1..326
GmPrx203 549 0 1..326 1..327
GmPrx103 548 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6602229..6602444 216 N° 2 6601928..6602119 192 N° 3 6601592..6601754 163 N° 4 6600979..6601388 410
complement(join(6600979..6601388,6601592..6601754,6601928..6602119,6602229..6602 444))


exon

Literature and cross-references MtPrx52 (Medtr5g017850.1[4.0] / Medtr5g017850.1[3.5] / Medtr5g017850.1[3.0])
Literature Manthey,K. et al., unpublished
DNA ref. Phytozome 12:   chr5 (6602444..6600979)
Cluster/Prediction ref. Phytozome Gene 12:   31088646 UniGene:   Mtr.7052
Omic ref. Gene atlas:   Mtr.38635.1.S1_at Legoo:   Mtr.38635.1.S1_at
Protein sequence: MtPrx52 (Medtr5g017850.1[4.0] / Medtr5g017850.1[3.5] / Medtr5g017850.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (301)
PWM (Da):   %s   35632.89 (32744.5) Transmb domain:   %s   o10-32i
PI (pH):   %s   6.85 (6.74) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MECVSNKHVFIFMFCLVFLTPLVCSQLYYNFYNRTCPNLNKIVKDNILSAIANDSRIAASLLRLHFHDCFVNGCDGSVLLDDTDTLKGEKNALPNKNSIRGFDVIDKIKSDLENACPSTVSCADILTLAARDAVYQSKGPFWAVPLGRRDGTTASESDANNLPSPFEPLENITAKFISKGLEKKDVAVLSGAHTFGFAQCFTFKPRLFDFGGSGKSDPSLDSSLLQNLQKVCPNQADSDSNLAPLDPVTTNTFDNTYYKNVLSNSGLLQSDQALLGDNTTSALVTNYSKWPILFFRDFAVSVEKMGRIGILAGQQGQIRKNCRAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 5 ESTs . In tandem with Prx ID 410
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGTGTCTCTAACAAACATGTTTTTATTTTCATGTTTTGTCTTGTGTTTCTTACTCCACTTGTGTGCTCTCAACTATATTACAATTTCTATAACAGAACTTGTCCAAATCTGAAC
AAAATTGTTAAAGACAATATCTTGTCAGCTATAGCTAATGATTCTAGGATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTTAAT
GTAATTAAGCTCTCTCAATTGTTG
TTTATCTTTTATTTTTGGTATTTATTTGCTCGAAATTTTTTATCAATCAACTATGTGTTTCTTATTTCATTTTTGTGTTACATAGGGATGTGATGGATCTGTGCTACTGGATGATACAGA
CACACTAAAAGGGGAGAAAAATGCACTTCCTAATAAAAATTCAATAAGAGGATTTGATGTAATTGATAAAATAAAGTCTGATTTAGAGAATGCTTGTCCTTCTACAGTGTCATGTGCTGA
TATACTTACTCTTGCAGCCAGAGATGCTGTATATCAA
GTAAGAACTCACTGTTTAATTATTTGGAGACTAAGTTAAAAATTTAATATATGATAATGCTTTTGGGGAACAAGAAAAACAGA
TTAATTGAATCATGCATGAGCAATAACCTCTTGAGTATTGCATGCATGCTTCCAACATATTATTAATCAAAACTTCTTTAATTATTTCAGAGTAAAGGGCCATTTTGGGCTGTACCTCTT
GGTCGTAGAGATGGAACAACCGCGAGTGAGAGCGACGCAAATAACTTGCCATCACCCTTTGAACCTCTAGAAAACATTACTGCCAAGTTCATTTCTAAGGGTCTTGAAAAGAAAGATGTA
GCAGTGCTCTCAG
GTTTGCTTCCCTTGCAATTATTTGTACCAAAATATTTATAACATGTATAACGTTTATGATTCGTGTTCGAATTATGTTATCGTCATTTTCAAGGCTAACATATTTCT
AACTCTAATGATCATAAGGTCCTTTCTTGTATATATATAAAGTTAGTGAAGAGACCAATTTCATGTGTATTGACTATGCACTCTCAATATATACAGGTGCACACACCTTTGGGTTCGCGC
AATGCTTTACATTCAAACCAAGGCTATTCGACTTTGGTGGCTCCGGTAAATCCGATCCATCGCTTGATTCTTCACTTCTACAGAACTTACAAAAAGTATGTCCAAATCAAGCTGATTCCG
ACTCCAATTTGGCTCCATTGGATCCCGTCACCACGAACACATTTGATAACACATATTACAAAAATGTTTTGAGCAATTCTGGGCTACTACAATCAGACCAAGCTCTTTTGGGTGACAATA
CAACTTCTGCATTGGTTACCAACTATAGCAAGTGGCCTATTCTGTTTTTCAGAGATTTTGCGGTTTCTGTTGAGAAAATGGGTCGCATTGGTATTCTTGCGGGACAGCAGGGTCAAATAA
GGAAAAATTGTAGGGCTGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGTGTCTCTAACAAACATGTTTTTATTTTCATGTTTTGTCTTGTGTTTCTTACTCCACTTGTGTGCTCTCAACTATATTACAATTTCTATAACAGAACTTGTCCAAATCTGAAC
AAAATTGTTAAAGACAATATCTTGTCAGCTATAGCTAATGATTCTAGGATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTTAAT
GGATGTGATGGATCTGTGCTACTG
GATGATACAGACACACTAAAAGGGGAGAAAAATGCACTTCCTAATAAAAATTCAATAAGAGGATTTGATGTAATTGATAAAATAAAGTCTGATTTAGAGAATGCTTGTCCTTCTACAGTG
TCATGTGCTGATATACTTACTCTTGCAGCCAGAGATGCTGTATATCAA
AGTAAAGGGCCATTTTGGGCTGTACCTCTTGGTCGTAGAGATGGAACAACCGCGAGTGAGAGCGACGCAAAT
AACTTGCCATCACCCTTTGAACCTCTAGAAAACATTACTGCCAAGTTCATTTCTAAGGGTCTTGAAAAGAAAGATGTAGCAGTGCTCTCAG
GTGCACACACCTTTGGGTTCGCGCAATGC
TTTACATTCAAACCAAGGCTATTCGACTTTGGTGGCTCCGGTAAATCCGATCCATCGCTTGATTCTTCACTTCTACAGAACTTACAAAAAGTATGTCCAAATCAAGCTGATTCCGACTCC
AATTTGGCTCCATTGGATCCCGTCACCACGAACACATTTGATAACACATATTACAAAAATGTTTTGAGCAATTCTGGGCTACTACAATCAGACCAAGCTCTTTTGGGTGACAATACAACT
TCTGCATTGGTTACCAACTATAGCAAGTGGCCTATTCTGTTTTTCAGAGATTTTGCGGTTTCTGTTGAGAAAATGGGTCGCATTGGTATTCTTGCGGGACAGCAGGGTCAAATAAGGAAA
AATTGTAGGGCTGTTAACTAA

Retrieve as FASTA