Entry information : SsqPrx01_Ox10 ( SSP4)
Entry ID 3774
Creation 2006-08-25 (Christophe Dunand)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-16 (Achraf Jemmat)
Peroxidase information: SsqPrx01_Ox10 ( SSP4)
Name (synonym) SsqPrx01_Ox10 ( SSP4)
Class Class III peroxidase    [Orthogroup: Prx157]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Senecio
Organism Senecio squalidus    [TaxId: 121554 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsqPrx01_Ox10
start..stop
S start..stop
SsqPrx01_OS-Bill4 661 0 1..326 1..326
SsqPrx01_Ox15 660 0 1..326 1..326
SsqPrx01_Ox8 654 0 1..326 1..326
SsqPrx01_A34-4-23 648 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23..421 399 N° 2 512..674 163 N° 3 758..1176 419  
join(23..421,512..674,758..1176)


exon

Literature and cross-references SsqPrx01_Ox10 ( SSP4)
Literature McInnis S.M., Costa L.M., Guttierez-Marcos J.F., Henderson C.A., Hiscock S.J. Isolation and characterization of a polymorphic stigma-specific class III peroxidase gene from Senecio squalidus L. (Asteraceae). Plant Mol. Biol. 57:659-677(2005)
Protein ref. UniProtKB:   Q4A3Z0
DNA ref. GenBank:   AJ810535.1 (23..1176)
Protein sequence: SsqPrx01_Ox10 ( SSP4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   35622.27 (32659.6) Transmb domain:   %s   i12-34o
PI (pH):   %s   7.97 (7.74) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEVYSRIRTPTILFVVIFAALTSLALGCKVGFYQATCPRAESIVQSVVKSAIRSNPTYAPGIPRLFFHDCFVNGCDASVLLDGSAPEQTASTNSHLRGFEVISTAKARVETECPGVVSCADILALAARDSVVETGLPRWEVPTGRRDGLVSRAEDALKLPGSRDSAEVQIEKFAAKGLNIEELVTLVGGHTIGTSACARFVHRLYNYSNTNAPDPHIDQASLPHLQTLCPEHGDRTIRVDLDTGSVNNFDTSYYENLRKGRGVLESDTKLWTHHITQNLVQQFISVGRPNQLTFSKKFARAMVKLSQVEVKTGNEGEIRRVCNRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3). Isolate="Ox 10".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTTTATTCCCGTATAAGAACACCCACAATCTTGTTTGTTGTCATTTTCGCCGCCTTGACCAGCCTGGCACTAGGTTGCAAAGTTGGGTTCTATCAGGCCACATGCCCGAGAGCG
GAATCCATTGTGCAGTCTGTGGTTAAGTCTGCCATCCGGTCTAACCCGACATATGCACCTGGTATACCAAGACTGTTTTTTCATGATTGTTTTGTTAATGGCTGTGATGCATCTGTTTTA
CTTGATGGTTCTGCTCCTGAGCAAACCGCTTCAACGAATTCTCATTTGAGAGGCTTTGAAGTCATCAGTACTGCAAAGGCTAGGGTCGAAACTGAATGTCCTGGAGTTGTATCTTGTGCG
GACATTCTTGCCCTCGCTGCTCGTGATTCTGTCGTCGAG
GTAATTGTTGTTTGTTTGTAAAACATGCAATAAAGAGTTATAACTGTTTAAACAAGTAACATTTTGATTTTTCAAACATAT
GCGTGCCAGACTGGGTTGCCTAGATGGGAAGTTCCAACAGGACGGAGAGATGGATTAGTTTCACGGGCCGAAGATGCTCTAAAATTGCCTGGTTCAAGGGATTCTGCTGAAGTCCAAATC
GAGAAGTTTGCAGCCAAAGGTCTTAATATCGAAGAACTTGTTACCCTTGTTG
GTAAGTTAACTATGCACAAAGAATGGAACTTACTACTGACAAAGAAATTAACATGTGTGTATCTCGGT
TTAATGGTTTATCAGGAGGACACACTATCGGGACATCCGCTTGTGCAAGATTCGTCCACAGGCTATATAACTATAGCAACACCAATGCACCGGATCCACATATTGACCAAGCATCCCTTC
CCCACCTACAAACCTTATGCCCAGAACATGGTGATAGAACAATCCGTGTGGACTTAGATACAGGTAGCGTAAACAATTTCGACACATCATACTATGAAAACTTGAGGAAGGGACGAGGAG
TACTTGAATCGGATACAAAGCTATGGACACACCATATCACACAAAACTTAGTGCAACAATTTATTTCTGTTGGGAGACCAAATCAGTTGACATTCTCCAAAAAGTTTGCGAGAGCAATGG
TGAAGTTAAGTCAAGTTGAGGTAAAGACCGGTAATGAAGGAGAAATTCGTAGGGTTTGTAACAGAATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTTTATTCCCGTATAAGAACACCCACAATCTTGTTTGTTGTCATTTTCGCCGCCTTGACCAGCCTGGCACTAGGTTGCAAAGTTGGGTTCTATCAGGCCACATGCCCGAGAGCG
GAATCCATTGTGCAGTCTGTGGTTAAGTCTGCCATCCGGTCTAACCCGACATATGCACCTGGTATACCAAGACTGTTTTTTCATGATTGTTTTGTTAATGGCTGTGATGCATCTGTTTTA
CTTGATGGTTCTGCTCCTGAGCAAACCGCTTCAACGAATTCTCATTTGAGAGGCTTTGAAGTCATCAGTACTGCAAAGGCTAGGGTCGAAACTGAATGTCCTGGAGTTGTATCTTGTGCG
GACATTCTTGCCCTCGCTGCTCGTGATTCTGTCGTCGAG
ACTGGGTTGCCTAGATGGGAAGTTCCAACAGGACGGAGAGATGGATTAGTTTCACGGGCCGAAGATGCTCTAAAATTGCCT
GGTTCAAGGGATTCTGCTGAAGTCCAAATCGAGAAGTTTGCAGCCAAAGGTCTTAATATCGAAGAACTTGTTACCCTTGTTG
GAGGACACACTATCGGGACATCCGCTTGTGCAAGATTC
GTCCACAGGCTATATAACTATAGCAACACCAATGCACCGGATCCACATATTGACCAAGCATCCCTTCCCCACCTACAAACCTTATGCCCAGAACATGGTGATAGAACAATCCGTGTGGAC
TTAGATACAGGTAGCGTAAACAATTTCGACACATCATACTATGAAAACTTGAGGAAGGGACGAGGAGTACTTGAATCGGATACAAAGCTATGGACACACCATATCACACAAAACTTAGTG
CAACAATTTATTTCTGTTGGGAGACCAAATCAGTTGACATTCTCCAAAAAGTTTGCGAGAGCAATGGTGAAGTTAAGTCAAGTTGAGGTAAAGACCGGTAATGAAGGAGAAATTCGTAGG
GTTTGTAACAGAATTAATTAA

Retrieve as FASTA