Entry information : MtPrx55 (Medtr1g025980.1[4.0]Medtr1g025980.1[3.5] / Medtr1g031890.1[3.0])
Entry ID 380
Creation 2006-08-28 (Christophe Dunand)
Last sequence changes 2006-08-28 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx55 (Medtr1g025980.1[4.0]Medtr1g025980.1[3.5] / Medtr1g031890.1[3.0])
Name (synonym) MtPrx55 (Medtr1g025980.1[4.0]Medtr1g025980.1[3.5] / Medtr1g031890.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducers Glomus versiforme infection
Mycorrhiza
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx55
start..stop
S start..stop
GmPrx253 538 0 3..318 2..316
CpapPrx26 498 1e-179 1..318 5..322
MePrx114 496 4e-179 17..317 19..319
PtPrx65 490 8e-177 1..318 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8362102..8362308 207 N° 2 8361806..8361994 189 N° 3 8361550..8361712 163 N° 4 8361054..8361451 398
complement(join(8361054..8361451,8361550..8361712,8361806..8361994,8362102..8362 308))


exon

Literature and cross-references MtPrx55 (Medtr1g025980.1[4.0]Medtr1g025980.1[3.5] / Medtr1g031890.1[3.0])
Literature Harrison,M.J. and al., unpublished.
Protein ref. UniProtKB:   Q1S8I0
DNA ref. Phytozome 12:   chr1 (8362308..8361054)
Cluster/Prediction ref. Phytozome Gene 12:   31096180
Omic ref. Gene atlas:   Mtr.46047.1.S1_at Legoo:   Mtr.46047.1.S1_at
Protein sequence: MtPrx55 (Medtr1g025980.1[4.0]Medtr1g025980.1[3.5] / Medtr1g031890.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (295)
PWM (Da):   %s   34293.61 (31941.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.78 (9.78) Peptide Signal:   %s   cut: 24 range:24-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTIGMVLLMMIMVSLTSLASALSVNYYEHTCPQVESIVAGAVHKATMNDKTVPSALLRMHFHDCFVRGCDGSVLLKTKGKNKAEKDGPPNISLHAFYVIDNAKKALEAVCPGVVSCADILALAARDAVTLSGGPNWEVPKGRKDGIISKATETRQLPAPTFNISQLQQSFSQRGLSLQDLVALSGGHTLGFAHCSSFQNRIHKFSPKQAVDPSLNPSFASNLQSKCHIKNKVKNSGSPLDSTATYFDNAYYKLLLQGKSILSSDQALLTHPTTKALVSKYAHSQMEFERAFVKSMIKMSSITNGGKQIRLQCNLVR

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 1 EST. Also found in AC202491 contig.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCAACTATTGGAATGGTGTTGCTCATGATGATAATGGTGTCCTTAACTTCTCTAGCAAGTGCATTAAGTGTGAATTACTATGAACATACATGTCCTCAGGTAGAATCCATCGTG
GCTGGTGCAGTACACAAAGCAACCATGAATGACAAAACAGTTCCATCAGCTCTGCTTCGCATGCATTTTCATGATTGCTTCGTAAGG
GTAATGATATATATATAAATATATATATGAATC
ACATGATTAGTATTTATTTATAGTATACTATATAGATTGATAACGTTTATTAATAAATAAATAAATTAATGAAGGGGTGTGATGGGTCTGTTCTGTTGAAAACAAAGGGAAAGAATAAAG
CAGAAAAGGATGGACCTCCAAACATATCATTGCATGCATTTTATGTAATTGATAATGCTAAGAAAGCATTGGAAGCAGTTTGTCCAGGGGTCGTGTCTTGTGCTGATATTTTGGCTCTTG
CTGCTAGAGACGCTGTCACTCTG
GTAAGTCACAATCACAAATGATGATATGAATTATAATAATTTAAAGGTTGCAGTAACAAATAACAATACATTTTTTGAGTGTCATGTCATTAGTCCG
GAGGGCCAAATTGGGAAGTACCAAAAGGAAGAAAGGATGGTATAATCTCAAAGGCTACTGAAACGAGACAATTGCCAGCTCCCACTTTCAACATCTCCCAATTACAACAAAGCTTCTCTC
AAAGAGGACTTTCCTTGCAAGATCTCGTTGCCCTCTCAG
GTACTATTTTCTTAAATCATCAAATAAACTTTACATTTTCAAACTATATATTATTACAATAACTGTTTGTTATATATATAT
ATATATATAATATGTAGGAGGTCACACCCTTGGTTTTGCACATTGTTCATCCTTCCAAAATAGAATCCATAAATTCAGCCCTAAACAAGCTGTTGACCCTTCCTTAAACCCATCATTTGC
AAGCAACCTCCAAAGCAAATGTCACATTAAAAACAAGGTGAAAAATTCAGGGTCCCCATTGGACTCAACTGCCACATATTTTGACAATGCTTATTACAAACTACTACTTCAAGGAAAAAG
CATACTCTCTTCTGATCAAGCTCTACTTACTCATCCAACCACTAAAGCATTGGTTTCCAAATATGCTCATTCCCAAATGGAATTTGAAAGAGCTTTTGTTAAATCCATGATCAAAATGAG
TAGCATCACCAATGGTGGAAAACAGATCAGGCTCCAATGTAATCTCGTTAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCAACTATTGGAATGGTGTTGCTCATGATGATAATGGTGTCCTTAACTTCTCTAGCAAGTGCATTAAGTGTGAATTACTATGAACATACATGTCCTCAGGTAGAATCCATCGTG
GCTGGTGCAGTACACAAAGCAACCATGAATGACAAAACAGTTCCATCAGCTCTGCTTCGCATGCATTTTCATGATTGCTTCGTAAGG
GGGTGTGATGGGTCTGTTCTGTTGAAAACAAAG
GGAAAGAATAAAGCAGAAAAGGATGGACCTCCAAACATATCATTGCATGCATTTTATGTAATTGATAATGCTAAGAAAGCATTGGAAGCAGTTTGTCCAGGGGTCGTGTCTTGTGCTGAT
ATTTTGGCTCTTGCTGCTAGAGACGCTGTCACTCTG
TCCGGAGGGCCAAATTGGGAAGTACCAAAAGGAAGAAAGGATGGTATAATCTCAAAGGCTACTGAAACGAGACAATTGCCAGCT
CCCACTTTCAACATCTCCCAATTACAACAAAGCTTCTCTCAAAGAGGACTTTCCTTGCAAGATCTCGTTGCCCTCTCAG
GAGGTCACACCCTTGGTTTTGCACATTGTTCATCCTTCCAA
AATAGAATCCATAAATTCAGCCCTAAACAAGCTGTTGACCCTTCCTTAAACCCATCATTTGCAAGCAACCTCCAAAGCAAATGTCACATTAAAAACAAGGTGAAAAATTCAGGGTCCCCA
TTGGACTCAACTGCCACATATTTTGACAATGCTTATTACAAACTACTACTTCAAGGAAAAAGCATACTCTCTTCTGATCAAGCTCTACTTACTCATCCAACCACTAAAGCATTGGTTTCC
AAATATGCTCATTCCCAAATGGAATTTGAAAGAGCTTTTGTTAAATCCATGATCAAAATGAGTAGCATCACCAATGGTGGAAAACAGATCAGGCTCCAATGTAATCTCGTTAGATGA

Retrieve as FASTA