Entry information : MtPrx70 (Medtr5g074760.1[4.0] / Medtr5g074760[3.5] / Medtr5g082700.1[3.0])
Entry ID 395
Creation 2006-06-22 (Christophe Dunand)
Last sequence changes 2013-12-29 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx70 (Medtr5g074760.1[4.0] / Medtr5g074760[3.5] / Medtr5g082700.1[3.0])
Name (synonym) MtPrx70 (Medtr5g074760.1[4.0] / Medtr5g074760[3.5] / Medtr5g082700.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Mycorrhizal roots
Root tips
Roots
Inducers Glomus intraradices infection
Mycorrhiza
Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx70
start..stop
S start..stop
MtPrx02 644 0 1..322 1..322
MtPrx86 605 0 1..322 1..322
GmPrx40 507 0 1..321 1..329
GmPrx120 495 1e-178 5..321 4..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31768581..31768790 210 N° 2 31768208..31768402 195 N° 3 31767323..31767889 567  
complement(join(31767323..31767889,31768208..31768402,31768581..31768790))


exon

Literature and cross-references MtPrx70 (Medtr5g074760.1[4.0] / Medtr5g074760[3.5] / Medtr5g082700.1[3.0])
Literature Manthey,K. et al., unpublished, Journet,E.P. et al, unpublished
Protein ref. UniProtKB:   Q1T3V2
DNA ref. Phytozome 12:   chr5 (31768790..31767323)
Cluster/Prediction ref. Phytozome Gene 12:   31089793
Omic ref. Gene atlas:   Mtr.14634.1.S1_at   Mtr.14635.1.S1_at   Mtr.14639.1.S1_x_at Legoo:   Mtr.14639.1.S1_x_at
Protein sequence: MtPrx70 (Medtr5g074760.1[4.0] / Medtr5g074760[3.5] / Medtr5g082700.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35838.5 (33254.1)  
PI (pH):   %s   9.7 (9.70) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSRFQFVLFVVTFATILSPTIAKLTPNYYDRICPKALPVIKSIVKQAIIREPRMGASLLRLHFHDCFVNGCDGSVLLDDTPTFIGEKTAFPNINSIRGFEVVDQIKAAVTKACKRDVVSCADILAIAARDSVAILGGKQYWYQVLLGRRDSRFASRDAANTNLPPPFFNFSQLITNFKSHGLNLKDLVVLSGGHTIGFSKCTNFRNRIYNDTNLDTNFAANLQKTCPKIGGDDNLAPFDSTPSRVDTKYYKALLNKQGLLHSDQELFKGDGSQSDRLVQLYSKNSYAFAYDFGVSMIKMGNLKPLTGKKGEIRCNCRKVNQN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, introns 1 and 2) and ESTs: AW256592, BE239560, CX549881, AW256591, AJ502110, AW687603, AL370987, BE240571 (Unigene compiles ESTs from MtPrx70 and 02). AC123575 contain 4 peroxidases (MtPrx01, 02, 70, 86) and one pseudogene.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCGTTTCCAATTCGTGCTTTTTGTGGTCACTTTTGCAACAATTTTGAGTCCTACCATTGCAAAGCTGACTCCAAATTATTATGACAGAATTTGTCCTAAGGCATTGCCAGTC
ATAAAGTCAATTGTTAAGCAAGCAATTATTCGTGAGCCACGCATGGGAGCATCATTGCTACGTTTGCATTTCCATGACTGCTTTGTTAAT
GTAAGTTAGTTGATTACATTTATAAAATTA
TGTTTAGCTTTATTATAGTCACAATACAGTTAATTTATATACATATTTATGTATGTGTAATGTGATACTGTTATCAAATTGTCACAATTACATATGAATCACTTATGTTATACATAGTCT
AATACATGAACATTGTGAATCTACACAGGGTTGTGATGGATCGGTTCTACTAGATGACACCCCTACCTTCATTGGTGAGAAGACTGCATTTCCAAATATCAATTCAATTAGAGGTTTTGA
GGTTGTTGATCAAATCAAAGCTGCAGTTACCAAAGCTTGCAAACGCGATGTCGTATCATGTGCCGATATTTTAGCTATAGCAGCTCGAGACTCTGTTGCCATT
GTAAGTCTTTCCAATAT
TTTGCACTTTTTAATCATGGTTTTAAATTGCACTAACCCTAATTGCGACTGCAATATAAAAAATAAAAAAAAATAATAGTCTTCTATGTTGCTAAATTTTTCTACAATACAAGTTTATAG
CATTACCGCAACCGAAACTCTAATTTAAAACCATGTTTAAATCAAACACTAAATATTGAAGGACACTCGTTGGCATTTTCTTTAATATTTTTTGGTTTTTTAATTTTTTGTTCACTCATT
CAACTTTTTCTAGCTAGTATATATAAGATTGACAACTAACAAATTTTGCTTCAATTAACAGTTGGGTGGTAAGCAATATTGGTACCAAGTGTTACTAGGAAGAAGAGATTCAAGATTTGC
AAGCAGGGATGCAGCAAATACAAATCTTCCTCCTCCATTCTTTAACTTCTCACAACTCATCACAAATTTCAAGTCACATGGACTAAACCTTAAAGATTTAGTTGTTCTATCTGGTGGTCA
CACAATTGGATTTTCCAAATGCACTAACTTTAGAAATAGGATCTACAATGACACCAACCTAGACACCAACTTTGCTGCCAATTTGCAAAAGACATGCCCTAAAATCGGCGGCGATGACAA
TCTAGCACCATTTGATTCTACTCCTTCAAGAGTTGACACAAAATACTATAAGGCTTTGTTGAATAAACAAGGTCTCCTTCATTCTGATCAAGAGCTTTTCAAAGGTGATGGTTCTCAAAG
TGATAGATTGGTTCAACTTTATAGTAAAAATTCTTATGCTTTTGCATATGATTTTGGAGTTTCTATGATTAAGATGGGTAACTTGAAGCCTCTTACCGGGAAAAAGGGTGAGATAAGGTG
CAATTGCAGAAAAGTTAATCAGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCGTTTCCAATTCGTGCTTTTTGTGGTCACTTTTGCAACAATTTTGAGTCCTACCATTGCAAAGCTGACTCCAAATTATTATGACAGAATTTGTCCTAAGGCATTGCCAGTC
ATAAAGTCAATTGTTAAGCAAGCAATTATTCGTGAGCCACGCATGGGAGCATCATTGCTACGTTTGCATTTCCATGACTGCTTTGTTAAT
GGTTGTGATGGATCGGTTCTACTAGATGAC
ACCCCTACCTTCATTGGTGAGAAGACTGCATTTCCAAATATCAATTCAATTAGAGGTTTTGAGGTTGTTGATCAAATCAAAGCTGCAGTTACCAAAGCTTGCAAACGCGATGTCGTATCA
TGTGCCGATATTTTAGCTATAGCAGCTCGAGACTCTGTTGCCATT
TTGGGTGGTAAGCAATATTGGTACCAAGTGTTACTAGGAAGAAGAGATTCAAGATTTGCAAGCAGGGATGCAGCA
AATACAAATCTTCCTCCTCCATTCTTTAACTTCTCACAACTCATCACAAATTTCAAGTCACATGGACTAAACCTTAAAGATTTAGTTGTTCTATCTGGTGGTCACACAATTGGATTTTCC
AAATGCACTAACTTTAGAAATAGGATCTACAATGACACCAACCTAGACACCAACTTTGCTGCCAATTTGCAAAAGACATGCCCTAAAATCGGCGGCGATGACAATCTAGCACCATTTGAT
TCTACTCCTTCAAGAGTTGACACAAAATACTATAAGGCTTTGTTGAATAAACAAGGTCTCCTTCATTCTGATCAAGAGCTTTTCAAAGGTGATGGTTCTCAAAGTGATAGATTGGTTCAA
CTTTATAGTAAAAATTCTTATGCTTTTGCATATGATTTTGGAGTTTCTATGATTAAGATGGGTAACTTGAAGCCTCTTACCGGGAAAAAGGGTGAGATAAGGTGCAATTGCAGAAAAGTT
AATCAGAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCAAATCAA AGTCTAATAC AAGCATATAG CAAATGGATT CTCGTTTCCA ATTCGTGCTT TTTGTGGTCA CTTTTGCAAC AATTTTGAGT CCTACCATTG CAAAGCTGAC TCCAAATTAT  TATGACAGAA TTTGTCCTAA GGCATTGCCA GTCATAAAGT CAATTGTTAA GCAAGCAATT ATTCGTGAGC CACGCATGGG AGCATCATTG CTACGTTTGC ATTTCCATGA CTGCTTTGTT  AATGGTTGTG ATGGATCGGT TCTACTAGAT GACACCCCTA CCTTCATTGG TGAGAAGACT GCATTTCCAA ATATCAATTC AATTAGAGGT TTTGAGGTTG TTGATCAAAT CAAAGCTGCA  GTTACCAAAG CTTGCAAACG CGATGTCGTA TCATGTGCCG ATATTTTAGC TATAGCAGCT CGAGACTCTG TTGCCATTTT GGGTGGTAAG CAATATTGGT ACCAAGTGTT ACTAGGAAGA  AGAGATTCAA GATTTGCAAG CAGGGATGCA GCAAATACAA ATCTTCCTCC TCCATTCTTT AACTTCTCAC AACTCATCAC AAATTTCAAG TCACATGGAC TAAACCTTAA AGATTTAGTT  GTTCTATCTG GTGGTCACAC AATTGGATTT TCCAAATGCA CTAACTTTAG AAATAGGATC TACAATGACA CCAACCTAGA CACCAACTTT GCTGCCAATT TGCAAAAGAC ATGCCCTAAA  ATCGGCGGCG ATGACAATCT AGCACCATTT GATTCTACTC CTTCAAGAGT TGACACAAAA TACTATAAGG CTTTGTTGAA TAAACAAGGT CTCCTTCATT CTGATCAAGA GCTTTTCAAA  GGTGATGGTT CTCAAAGTGA TAGATTGGTT CAACTTTATA GTAAAAATTC TTATGCTTTT GCATATGATT TTGGAGTTTC TATGATTAAG ATGGGTAACT TGAAGCCTCT TACCGGGAAA  AAGGGTGAGA TAAGGTGCAA TTGCAGAAAA GTTAATCAGA ACTGAATATT ATAATGATGG ATGGACTACA GCAGAATGAA GAAAGATAAA GATTGATTAA TTGTTTAATA TAAAGTTGTG 
CCAATTTTTT TATGCTCTAT AAATTATTCA AATATTTTGA TTGTTGAGAA TAATAATTCT AGGTTCAAAA CAGAACCATG AATTGTTAAG GAGTCTGTTA AACGTGATTT TC 

Retrieve as FASTA