Entry information : MtPrx26 (Medtr2g029860.1 [4.0] / Medtr2g029860.1 [3.5] )
Entry ID 405
Creation 2005-06-16 (Christophe Dunand)
Last sequence changes 2014-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-07-16 (Christophe Dunand)
Peroxidase information: MtPrx26 (Medtr2g029860.1 [4.0] / Medtr2g029860.1 [3.5] )
Name (synonym) MtPrx26 (Medtr2g029860.1 [4.0] / Medtr2g029860.1 [3.5] )
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Stems
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx26
start..stop
S start..stop
MsPrx01 687 0 1..353 1..350
PsPrx14 620 0 1..353 1..356
GmPrx24 563 0 10..353 7..350
GmPrx260 551 0 20..353 15..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11176807..11177028 222 N° 2 11177180..11177371 192 N° 3 11178510..11178675 166 N° 4 11178774..11179255 482
join(11176807..11177028,11177180..11177371,11178510..11178675,11178774..11179255 )


exon

Literature and cross-references MtPrx26 (Medtr2g029860.1 [4.0] / Medtr2g029860.1 [3.5] )
Literature He,X.-Z. et al., unpublished
DNA ref. Phytozome 12:   chr2 (11176807..11179255)
Cluster/Prediction ref. Phytozome Gene 12:   31064880
Omic ref. Gene atlas:   Mtr.40132.1.S1_at Legoo:   Mtr.40132.1.S1_at
Protein sequence: MtPrx26 (Medtr2g029860.1 [4.0] / Medtr2g029860.1 [3.5] )
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (326)
PWM (Da):   %s   37342.02 (34599.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.12 (4.12) Peptide Signal:   %s   cut: 28 range:28-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNPLGLSATAFCCVVFVFIGGVPFSNAQLDPSFYNSTCSNVDSIVRGVLTNVSQSDPRMLGSLIRLHFHDCFVQGCDASILLNDTATIVSEQSAPPNNNSIRGLDVINQIKTAVENACPNTVSCADILALSAEISSDLANGPTWQVPLGRRDSLTANNSLAAQNLPAPTFNLTQLKSSFDNQNLTTTDLVALSGGHTIGRGQCRFFVDRLYNFSNTGNPDSTLNTTYLQTLQAICPNGGPGTNLTDLDPTTPDTFDSNYYSNLQVGNGLFQSDQELFSTNGSDTISIVNSFANNQTLFFENFVASMIKMGNIGVLTGSQGEIRTQCNAVNGNSSGLASVVTKESSEDGMASSF

Retrieve as FASTA  
Remarks Complete sequence from 5 ESTs and genomic sequence (chromo 2, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCACTTGGTCTAAGTGCAACAGCTTTTTGTTGTGTCGTTTTTGTGTTTATTGGAGGAGTACCCTTTTCAAATGCACAACTAGATCCTTCATTTTACAATAGTACATGTTCTAAT
GTTGATTCAATCGTACGTGGTGTGCTCACAAATGTTTCACAATCTGATCCCAGAATGCTTGGTAGTCTCATTAGGCTACATTTTCATGACTGTTTTGTTCAA
GTATGTGTGTTCTGATCC
ATCTCTTACCTTCACATTTTCACTTTTGTGGACGGTGAACATGATTTCGTCAAATTCGTTGTGATTTCAATCAAACATACACACATAATGAGTTCAAATGTATATATGCTAATAGTTGTG
AACATTGTTGCAGGGTTGCGATGCATCGATTTTGCTGAACGATACGGCTACGATAGTGAGCGAGCAAAGTGCACCACCAAATAACAACTCCATAAGAGGTTTGGACGTGATAAACCAGAT
CAAAACAGCGGTGGAAAATGCTTGTCCTAACACTGTTTCTTGTGCTGATATTCTTGCCCTTTCTGCTGAAATATCTTCTGATCTG
GTATATATTTCCTAGCTAGTTTCCTAGTCATACAT
TTAAATTAACTTCTAGCTAGATAGTATGTTGTTTAATTTCAAAACTTCCATGTTCGTAGAAAATAAAAATGAAAATCTTCACATTATGGAAAACGAATGCAATAAATAAAATGTATCCAA
AGATCTCATAAACGATCAATAAATCAGTTTTGACAAAGTAGTTAATAGTCAAAACTATTAACACCCCTACATTTTTTCTAATATACATATACTTTTAATAATTTATTTCTGGACGGAAAA
AATTGCCAAATTTTCTTATTTTCAAACGGTAAAATGTATTTAGAAAAATACGCATTCAAAATAAACTTACAAAACTATATTGATGGTGTGTTAGCAAAAAACAGATGTCAATAGGTAAAT
AAATAGGTTATGTTATATGAACAACTGTTTTTGGAACAACTTATAAAACAATCAAGGTATACAAAGAAACGTGGATATTATATTAGTACGAAAATCAAAGTAAATAGAGTAAGGACACGA
TGAGAGTATAAAAAAGAGAATTGTTCTAAACCATTTCTGGGACAACTAATAAGAGGATAATAATAGAAATGTAAGCATCGACACTATAACCAAATCAATAAAGAGAATAAGAATACAATA
AAAATATGAAAAAAGGAGTTATCCCTAAATAGTTATTCAAATATAATTTCTCAATTATATATATAATTGGTGGGATTTCACAAGCTTGTAAGCCCCAATTCGGGTAAGGCAAGGCTATCA
AATGGTGTGGTCCAGCAGTAGCATAGACTTTTATATTGTGTCTGGTTATGTATATTTTGGTTTGTAGAGATCTGATGGTTTTAATTTTACATGATCATATCTTATGCTATAAAGTTGTAC
TTTCGTTATCATGTTGTTTTATGATGTTTTTTTATATACATTGGTAAAGAAATACTAACCGTAAAATAAATAGTTAAAATAGTTTTGTACATAATGAATTAGTTATTTGCCTAAAATTTT
GACTAGTTTAAATAATTCAAACAAATCATAATCAAAGATATGTGACAATGTACGTTCTTCATAGAATTTCAATTTTATTAATTAACATCATAAACCATGATATATATTTTCTTTATTATC
CTACAATGCAACAAAAATTGCAGGCAAATGGTCCTACTTGGCAAGTTCCATTAGGAAGAAGGGATAGTTTAACAGCAAATAATTCCCTTGCAGCTCAAAATCTTCCTGCCCCCACTTTCA
ACCTTACTCAACTAAAATCTAGCTTTGATAATCAAAACCTCACTACTACTGATCTAGTTGCACTCTCAG
GTATAATTTTTTTGTTTCTTCAAAATATGTAACATGAATGTATGTACATAT
AGTCTAAAAATGACTCATATTAAGAATCCCCCCATTTAATTTTTTAGGTGGTCATACAATTGGAAGAGGTCAATGCAGATTTTTCGTTGATCGATTATACAATTTCAGCAACACTGGAAA
TCCCGATTCAACCCTTAACACAACTTACTTGCAAACATTGCAAGCAATATGTCCCAATGGTGGACCTGGTACGAACCTAACCGATTTGGACCCAACGACACCTGATACATTTGACTCCAA
CTACTACTCCAATCTCCAAGTTGGAAATGGCTTGTTTCAAAGTGACCAAGAGCTTTTTTCCACAAATGGTTCTGACACTATTTCTATTGTCAATAGTTTCGCCAATAATCAAACTCTCTT
CTTTGAAAATTTTGTTGCTTCAATGATAAAAATGGGTAATATTGGAGTTTTAACTGGATCTCAAGGTGAAATTAGAACACAATGTAATGCTGTGAATGGGAATTCTTCTGGATTGGCTTC
TGTAGTCACCAAAGAATCATCAGAAGATGGAATGGCTAGCTCATTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCACTTGGTCTAAGTGCAACAGCTTTTTGTTGTGTCGTTTTTGTGTTTATTGGAGGAGTACCCTTTTCAAATGCACAACTAGATCCTTCATTTTACAATAGTACATGTTCTAAT
GTTGATTCAATCGTACGTGGTGTGCTCACAAATGTTTCACAATCTGATCCCAGAATGCTTGGTAGTCTCATTAGGCTACATTTTCATGACTGTTTTGTTCAA
GGTTGCGATGCATCGATT
TTGCTGAACGATACGGCTACGATAGTGAGCGAGCAAAGTGCACCACCAAATAACAACTCCATAAGAGGTTTGGACGTGATAAACCAGATCAAAACAGCGGTGGAAAATGCTTGTCCTAAC
ACTGTTTCTTGTGCTGATATTCTTGCCCTTTCTGCTGAAATATCTTCTGATCTG
GCAAATGGTCCTACTTGGCAAGTTCCATTAGGAAGAAGGGATAGTTTAACAGCAAATAATTCCCTT
GCAGCTCAAAATCTTCCTGCCCCCACTTTCAACCTTACTCAACTAAAATCTAGCTTTGATAATCAAAACCTCACTACTACTGATCTAGTTGCACTCTCAG
GTGGTCATACAATTGGAAGA
GGTCAATGCAGATTTTTCGTTGATCGATTATACAATTTCAGCAACACTGGAAATCCCGATTCAACCCTTAACACAACTTACTTGCAAACATTGCAAGCAATATGTCCCAATGGTGGACCT
GGTACGAACCTAACCGATTTGGACCCAACGACACCTGATACATTTGACTCCAACTACTACTCCAATCTCCAAGTTGGAAATGGCTTGTTTCAAAGTGACCAAGAGCTTTTTTCCACAAAT
GGTTCTGACACTATTTCTATTGTCAATAGTTTCGCCAATAATCAAACTCTCTTCTTTGAAAATTTTGTTGCTTCAATGATAAAAATGGGTAATATTGGAGTTTTAACTGGATCTCAAGGT
GAAATTAGAACACAATGTAATGCTGTGAATGGGAATTCTTCTGGATTGGCTTCTGTAGTCACCAAAGAATCATCAGAAGATGGAATGGCTAGCTCATTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAAAAGAAAA AAAATGAATC CACTTGGTCT AAGTGCAACA GCTTTTTGTT GTGTCGTTTT TGTGTTTATT GGAGGAGTAC CCTTTTCAAA TGCACAACTA GATCCTTCAT TTTACAATAG  TACATGTTCT AATGTTGATT CAATCGTACG TGGTGTGCTC ACAAATGTTT CACAATCTGA TCCCAGAATG CTTGGTAGTC TCATTAGGCT ACATTTTCAT GACTGTTTTG TTCAAGGTTG  CGATGCATCG ATTTTGCTGA ACGATACGGC TACGATAGTG AGCGAGCAAA GTGCACCACC AAATAACAAC TCCATAAGAG GTTTGGACGT GATAAACCAG ATCAAAACAG CGGTGGAAAA  TGCTTGTCCT AACACTGTTT CTTGTGCTGA TATTCTTGCC CTTTCTGCTG AAATATCTTC TGATCTGGCA AATGGTCCTA CTTGGCAAGT TCCATTAGGA AGAAGGGATA GTTTAACAGC  AAATAATTCC CTTGCAGCTC AAAATCTTCC TGCCCCCACT TTCAACCTTA CTCAACTAAA ATCTAGCTTT GATAATCAAA ACCTCACTAC TACTGATCTA GTTGCACTCT CAGGTGGTCA  TACAATTGGA AGAGGTCAAT GCAGATTTTT CGTTGATCGA TTATACAATT TCAGCAACAC TGGAAATCCC GATTCAACCC TTAACACAAC TTACTTGCAA ACATTGCAAG CAATATGTCC  CAATGGTGGA CCTGGTACGA ACCTAACCGA TTTGGACCCA ACGACACCTG ATACATTTGA CTCCAACTAC TACTCCAATC TCCAAGTTGG AAATGGCTTG TTTCAAAGTG ACCAAGAGCT  TTTTTCCACA AATGGTTCTG ACACTATTTC TATTGTCAAT AGTTTCGCCA ATAATCAAAC TCTCTTCTTT GAAAATTTTG TTGCTTCAAT GATAAAAATG GGTAATATTG GAGTTTTAAC  TGGATCTCAA GGTGAAATTA GAACACAATG TAATGCTGTG AATGGGAATT CTTCTGGATT GGCTTCTGTA GTCACCAAAG AATCATCAGA AGATGGAATG GCTAGCTCAT TCTAAACATA  CGCTTGGAAA ATATCGAAGA GGTTCAATAT TTTCTGCATA CATATATGAT GTGTGTATGT GGTGGATCAC GATAATTAAT CTCTGCTTGT ATGCTCTTTC TAGTTCTATA CTATGTTTTT 
GTTTTGTTCT TCAAGTTGAT TGGGGACCGT AGAAGCTCCC TAA 

Retrieve as FASTA