Entry information : RsKat01 ( cat1)
Entry ID 4084
Creation 2006-11-14 (Christophe Dunand)
Last sequence changes 2016-01-20 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-20 (Christophe Dunand)
Peroxidase information: RsKat01 ( cat1)
Name (synonym) RsKat01 ( cat1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Raphanus
Organism Raphanus sativus (Chinese radish)    [TaxId: 3726 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RsKat01
start..stop
S start..stop
BjKat02 1026 0 1..492 1..492
BjKat04 1021 0 1..492 1..492
AlyKat02 1021 0 1..492 1..492
BjKat03 1019 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4077..4091 15 N° 2 4284..4380 97 N° 3 4483..4760 278 N° 4 5230..6006 777
N° 5 6081..6170 90 N° 6 6252..6319 68 N° 7 6431..6524 94 N° 8 6635..6694 60
join(4077..4091,4284..4380,4483..4760,5230..6006,6081..6170,6252..6319,6431..652 4,6635..6694)


exon

Literature and cross-references RsKat01 ( cat1)
Literature Kwon,S.-I. and An,C.-S. Characterization and expression of the catalase gene from small radish. Unpublished
Protein ref. GenBank:   AAF71742.1 UniProtKB:   O22640
DNA ref. GenBank:   AF248491.1 (2039..4656)
Protein sequence: RsKat01 ( cat1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56668.19  
PI (pH):   %s   7.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPASSYNSPFFTTNSGAPVWNNNSSMTVGPRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDISNLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFIRDGMKFPDMVHALKPNPKSHIQENWRVLDFFSHHPESLNMFTFLFDDIGIPQDYRHMEGSGVNTYMLINKSGKAHYVKFHWKPTCGVKSLLEEDAIRVGGTNHSHATQDLYDSIAAGNYPEWKLFVQIIDPADEDKFDFDPLDVTKTWPEDLLPLQPVGRMVLNKNIDNFFAENEQLAFCPAIIVPGIHYSDDKLLQTRVFSYADTQRHRLGPNYLQLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRYDPVRHAEKYPTPPAVCSGKRERCIIEKENNFKEPGERYRSFTPERQERFIGRWIDALSDPRITHEIRSIWISYWSADKSLGQKLASRLNVRPSI*

Retrieve as FASTA  
Remarks Complete sequence from cDNA.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTACGACTCTCTCCTTTATCTTTCACCTCTTCATCTTCGTTAGAAACTGGTTTCGTTCTAGCTTTGTTATTGCACCCGATTTTGTAGCCTTCGTAACTGTTTGAT
TGGTGTCCATGTCGGATCTTGACTTTCTTTCTAGTCGAATCTGTGAATCTTGATCCTGTTGATGAATGGTTTTGATCTTGTTTGCAGTATCGTCCAGCGAGTTCATACAACTCTCCATTC
TTCACCACCAACTCCGGTGCTCCTGTATGGAACAACAACTCCTCCATGACCGTTGGACCCAGAG
GTATATATATATATTCATCTCTCTTCTTCTCAAAACGATATCGTTTCATTCATGAG
TATATGATGTATATGTTAAGTGTTACACTTGTGATTGTTGTGGCAGGTCCTATCCTTCTTGAGGATTACCATCTCGTTGAGAAGCTTGCCAACTTCGACAGGGAGCGTATTCCAGAGCGT
GTGGTTCATGCTAGAGGAGCAAGTGCAAAGGGTTTCTTCGAGGTCACTCATGATATATCTAACCTCACGTGTGCCGACTTCCTCAGAGCTCCAGGTGTTCAGACCCCAGTCATTGTTCGT
TTCTCCACTGTCATCCATGAGCGTGGAAGTCCCGAGACCTTGAGAGACCCTCGTGGCTTTGCCGTCAAGTTCTACACCAGAGAG
GTCAAGTCACCACTACTTATAACATACTAAAAACAT
TTATTTGTTTGGTATACGAAATTTGGAAGGCTATTGATAATTTAATAGGGAATATATTCGGTTTCAGAAAGATCCATGTTTTTTATTTAAAATTTCATTTAAGAAAATACATGTTTATAT
TTTCAATGCATTCATAAATGGTAAACTGTTAATTTTTAATACAATACTTGTGTTTATTTATACCTTATTGGTTAAAAGTTGTAGGGAATAGTTAACTTTAAATTTGATAAGGTTTTCTTA
AAAAGTTTACAAAATGTGATAATGATAAGACATTTTTGTAACTTTGTAGTGTATATTTATTTTAGTTTTAAAGATTTATAATGTATGATAATTTTCACATAAATTTGTTTTGAAGGCTTC
AGACCAATTGTTTCACTAGCAATATGCTCAGGTTGATATATGCTAATAGCAATTGATCATGGTATTGGAGAAGGGAAACTTTGATCTTGTCGGAAACAACTTCCCTGTCTTCTTCATCCG
CGACGGTATGAAGTTCCCTGACATGGTCCACGCTCTTAAGCCAAACCCAAAATCTCACATCCAAGAGAACTGGAGAGTCCTTGACTTCTTCTCCCACCACCCTGAGAGCTTAAACATGTT
CACTTTCCTTTTCGATGACATCGGTATCCCACAAGACTACCGCCACATGGAAGGTTCAGGTGTCAACACATACATGCTGATCAACAAATCCGGCAAAGCTCACTACGTGAAGTTCCACTG
GAAACCAACATGTGGAGTCAAGTCTCTGTTAGAAGAAGATGCAATCCGCGTTGGTGGAACCAACCACAGCCACGCGACTCAGGACTTGTACGACTCCATCGCTGCTGGTAACTACCCTGA
GTGGAAGCTCTTTGTTCAGATAATCGATCCGGCGGATGAAGACAAGTTCGACTTTGACCCTCTCGATGTGACCAAGACCTGGCCTGAGGATCTCTTGCCTCTCCAGCCCGTTGGTCGTAT
GGTGTTGAACAAGAACATTGATAACTTCTTTGCGGAGAATGAGCAGCTTGCCTTCTGCCCTGCGATCATTGTTCCGGGGATACACTACTCTGATGACAAGCTGCTTCAAACACGTGTCTT
CTCCTATGCGGATACTCAGAGACACCGTCTTGGACCTAACTACCTTCAGCTACCAGTGAATGCTCCAAAATGTGCTCACCACAACAACCACCATGAGGGCTTCATGAATTTCATGCACAG
GGACGAGGAG
GTAATGTCTTTTTTTTTTGTAATGAACTTCATGCTAGAATATCGTTTTCTTACAAAAAAGGTGGTTTGGTACAGGTTAACTACTTCCCTTCGAGGTATGACCCGGTTCGC
CATGCTGAGAAGTATCCAACTCCACCAGCAGTCTGCTCTGGGAAGCGTGAGAGG
GTCAGTAATCAAATCAACTCTCTCTTTCAGTTTCCTCGTAAGAAGGCATATGTTTTAAAAGTTCAA
ATTCTGTTTTGGCAGTGCATTATTGAGAAAGAGAACAACTTCAAGGAGCCTGGAGAGAGATACCGTTCCTTTACACCAGAGAGGTATTCATTGTTTCTTAACTCCTTTTTTTTTTCTGGT
AAACAAACCCCTGTTTTGGTTATACTCAATACATTTACATGCTCTTATTGTTTTACTGTTGATTTTAACTTCAGGCAAGAACGTTTCATCGGTAGATGGATTGATGCTCTATCAGACCCT
CGCATCACACATGAAATCCGCAGTATCTGGATCTCTTACTGGTCTCAG
GTATAGAGTCTGAATACTGTCATTGTCTGTTTTCTTGAGCCTAATAAAAGAGAGTTTTGAAGTTTTGTAATA
ATTTTTTTACACTGATTGGGTAAAAAATTGTGGAACAGGCTGATAAGTCACTGGGACAGAAGCTGGCAAGCCGTCTGAACGTGAGACCAAGCATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGTATCGTCCAGCGAGTTCATACAACTCTCCATTCTTCACCACCAACTCCGGTGCTCCTGTATGGAACAACAACTCCTCCATGACCGTTGGACCCAGAGGTCCTATC
CTTCTTGAGGATTACCATCTCGTTGAGAAGCTTGCCAACTTCGACAGGGAGCGTATTCCAGAGCGTGTGGTTCATGCTAGAGGAGCAAGTGCAAAGGGTTTCTTCGAGGTCACTCATGAT
ATATCTAACCTCACGTGTGCCGACTTCCTCAGAGCTCCAGGTGTTCAGACCCCAGTCATTGTTCGTTTCTCCACTGTCATCCATGAGCGTGGAAGTCCCGAGACCTTGAGAGACCCTCGT
GGCTTTGCCGTCAAGTTCTACACCAGAGAG
GGAAACTTTGATCTTGTCGGAAACAACTTCCCTGTCTTCTTCATCCGCGACGGTATGAAGTTCCCTGACATGGTCCACGCTCTTAAGCCA
AACCCAAAATCTCACATCCAAGAGAACTGGAGAGTCCTTGACTTCTTCTCCCACCACCCTGAGAGCTTAAACATGTTCACTTTCCTTTTCGATGACATCGGTATCCCACAAGACTACCGC
CACATGGAAGGTTCAGGTGTCAACACATACATGCTGATCAACAAATCCGGCAAAGCTCACTACGTGAAGTTCCACTGGAAACCAACATGTGGAGTCAAGTCTCTGTTAGAAGAAGATGCA
ATCCGCGTTGGTGGAACCAACCACAGCCACGCGACTCAGGACTTGTACGACTCCATCGCTGCTGGTAACTACCCTGAGTGGAAGCTCTTTGTTCAGATAATCGATCCGGCGGATGAAGAC
AAGTTCGACTTTGACCCTCTCGATGTGACCAAGACCTGGCCTGAGGATCTCTTGCCTCTCCAGCCCGTTGGTCGTATGGTGTTGAACAAGAACATTGATAACTTCTTTGCGGAGAATGAG
CAGCTTGCCTTCTGCCCTGCGATCATTGTTCCGGGGATACACTACTCTGATGACAAGCTGCTTCAAACACGTGTCTTCTCCTATGCGGATACTCAGAGACACCGTCTTGGACCTAACTAC
CTTCAGCTACCAGTGAATGCTCCAAAATGTGCTCACCACAACAACCACCATGAGGGCTTCATGAATTTCATGCACAGGGACGAGGAG
GTTAACTACTTCCCTTCGAGGTATGACCCGGTT
CGCCATGCTGAGAAGTATCCAACTCCACCAGCAGTCTGCTCTGGGAAGCGTGAGAGG
TGCATTATTGAGAAAGAGAACAACTTCAAGGAGCCTGGAGAGAGATACCGTTCCTTTACACCA
GAGAG
GCAAGAACGTTTCATCGGTAGATGGATTGATGCTCTATCAGACCCTCGCATCACACATGAAATCCGCAGTATCTGGATCTCTTACTGGTCTCAGGCTGATAAGTCACTGGGACAG
AAGCTGGCAAGCCGTCTGAACGTGAGACCAAGCATCTAA

Retrieve as FASTA