Entry information : HaKat01 ( HanXRQChr08g0216441)
Entry ID 4087
Creation 2006-11-14 (Christophe Dunand)
Last sequence changes 2016-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaKat01 ( HanXRQChr08g0216441)
Name (synonym) HaKat01 ( HanXRQChr08g0216441)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue types Cotyledons
Embryos
Leaves
Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaKat01
start..stop
S start..stop
HaKat07 964 0 1..492 1..492
HaKat06 962 0 1..492 1..492
PpeKat01 948 0 1..491 1..491
VvKat02 947 0 1..491 1..491
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28487784..28487798 15 N° 2 28488488..28488584 97 N° 3 28488693..28488970 278 N° 4 28489064..28489840 777
N° 5 28489949..28490038 90 N° 6 28490263..28490330 68 N° 7 28490407..28490500 94 N° 8 28490580..28490639 60
join(28487784..28487798,28488488..28488584,28488693..28488970,28489064..28489840 ,28489949..28490038,28490263..28490330,28490407..28490500,28490580..28490639)


exon

Literature and cross-references HaKat01 ( HanXRQChr08g0216441)
Literature Kleff,S., Trelease,R.N. and Eising,R. Nucleotide and deduced amino acid sequence of a putative higher molecular weight precursor for catalase in sunflower cotyledons. Biochim. Biophys. Acta 1224 (3), 463-466 (1994)
Protein ref. UniProtKB:   P45739
DNA ref. HanXRQ genome:   HanXRQChr08 (28487784..28490639)
mRNA ref. GenBank:   L28740.1
EST ref. GenBank:   DY914571.1 [5' end]   GE521657.1 [3' end]
Cluster/Prediction ref. HanXRQ:   HanXRQChr08g0216441 UniGene:   Han.670
Protein sequence: HaKat01 ( HanXRQChr08g0216441)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56556.2  
PI (pH):   %s   7.1
Sequence 533
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRSSSAYNAPFWTTNSGAPVYNNNNSLTVGSRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDITALTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNFDLVGNNFPVFFIRDGMKFPDMVHSLKPNPKSHIQEDWRIMDFFSHHPESLHMFTFLLDDIGVPQDYRHMDGSGVNTYTLINKAGKAYYVKFHWKPTCGVKSLLEEEAIKIGGANHSHATQDLYDSIAAGNYPEWKLFIQTIDPDHEDRLDFDPLDVTKTWPEDIFPLQPVGRLVLNKNIDNFFAENEQLAFCPAIIVPGIYYSDDKLLQTRIFSYSDTQRHRLGPNYLQLPANAPKCAHHNNHYDGFMNFMHRDEEIDYFPSRYDPARHAEQYPIPPVRLSGKRDKCVIEKENNFKQPGERYRSFSPDRQERFINRVVGGLSDPRVTHEVRSIWVSYWSQADKSLGQKIASRLNVKPNY

Retrieve as FASTA  
Remarks Complete sequence from genomic, 1 cDNA and 11 ESTs. Strain="Spanners Allzweck", "HA89" and "ANN1312".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATCCTTACAAGGTACTACTGCATCACTCTAATCTTGTGTTTGCACATCATCTACTGATTCACAGTTGTTCTGTTATTATTTCTGTATAAAACACATCGGTTAGGGTTTATGATCGTT
AGGGTTCAGTCTGTTATATACATGTATTGGATTTTATGCCTGATTACTTTATTTTACCTGATTTTGATTTAATTGAAGATATTTGAAAAGGTTTTGTTGTATTAGATCAGTTTTGACCTG
ACTCTGAGATTCAGTTCATGTTATTTAGGAACTATAGAGATCGAACTCGATATCGATATATCGATATCGATATAGACGCAATTTAACTCATGAATATTTAGTTGTGATAAAGGAAAACAC
AAATTTGTTAGTCATGTTAAGTTTTTTTTTTAGATCAAAAGCTAAATTTATTTAACTTCATAGGGAAATCTGATTAATTTTTTGATTATTTAAGTAGTGGATATATGCTTTTATCTAGTT
ATTTCAAAGCTTTTGGCTGTAAATATGTAAAAAAGAAGTTTGAATACTTTTGTAATTGTTTGAAGTAAACCATGTTGACTCGATTTACCTACAAAATCTTTGTTGATCAAGATACCAAAC
CGTGCAATGAACGATTGTTCTTCTTGCGGTTAATTGCAGTATAGTGTTTTTTTTTTTGGGATTGAGTGTATATTTATGGATTTTACTTTTTCGATTGATGCAGTACCGTTCTTCAAGTGC
CTACAATGCCCCATTCTGGACCACCAATTCCGGTGCTCCGGTTTACAACAACAACAACTCATTGACCGTCGGAAGCAGAG
GTATCTAAATTTGATGTCTGTTAGTTTTTCGCTACAAAAG
TTGGGATTTCTTGGTAGACTATTTTATATAAAATTTCTGCTAATTATGATTTTATTTTTGTACGATAGGTCCAATCCTTCTAGAAGATTACCATTTGGTGGAGAAGCTAGCTAACTTCGA
CCGTGAGCGTATCCCTGAACGTGTCGTTCATGCCAGAGGTGCCAGTGCTAAGGGATTTTTTGAAGTCACACATGACATTACTGCCCTCACATGTGCTGATTTTCTCCGTGCCCCCGGTGT
CCAGACTCCTGTTATCGTTCGTTTCTCTACTGTTATCCATGAACGTGGTAGCCCCGAAACCCTCAGGGACCCTAGAGGTTTCGCAGTGAAGTTCTACACCCGAGAG
GTAACACACAAACA
CATCTATATCTATATGTGTATATGTAGGGTAAATGTTACTTTATCATATGTGATGTTTACCAATTGTTTACATTTGTAGGGTAACTTTGATTTGGTGGGAAACAATTTCCCGGTGTTCTT
TATTCGTGATGGAATGAAATTTCCCGACATGGTTCACTCGTTGAAACCAAACCCTAAATCGCACATTCAAGAAGACTGGAGAATCATGGACTTTTTCTCTCACCATCCCGAGAGTTTGCA
CATGTTCACATTTCTTCTAGACGATATCGGTGTGCCACAAGATTACCGCCACATGGACGGATCCGGTGTCAACACCTACACTTTGATCAACAAAGCTGGAAAAGCATATTACGTGAAGTT
CCACTGGAAACCAACATGTGGCGTAAAAAGTTTGTTGGAAGAAGAAGCCATCAAGATCGGTGGAGCGAATCACAGCCATGCTACACAAGATCTTTACGATTCGATTGCTGCTGGAAACTA
CCCCGAGTGGAAGCTTTTTATCCAGACCATTGATCCGGATCACGAGGATCGGCTCGACTTTGACCCGCTTGATGTTACCAAGACCTGGCCTGAGGATATCTTTCCGTTGCAGCCTGTGGG
TCGTCTGGTTTTGAACAAGAATATTGACAACTTCTTTGCTGAGAATGAACAGCTGGCATTTTGTCCTGCTATCATTGTTCCTGGAATCTATTATTCTGATGATAAGTTGCTGCAAACCCG
TATTTTCTCGTATTCTGACACTCAGAGGCACCGTCTTGGACCGAACTATTTGCAGCTTCCTGCAAATGCTCCTAAGTGTGCTCATCATAATAATCACTATGATGGATTCATGAATTTCAT
GCACAGAGATGAGGAG
GTACACCTTTATATATGTATTATGTATACTCATTTGAAAACATTAACAATCAAAACAAACTACAATAATACATTTTCTTATTTACTCCTTTTATCATTACTTCT
GCAGATCGATTACTTCCCTTCAAGATATGATCCCGCTCGTCATGCTGAGCAGTACCCTATTCCTCCTGTTAGGTTGTCCGGAAAGCGTGATAAGGTCAGTTTATTACTTTTAAAATGTGG
TATTAACGCAGGCTTTAGACTTCAACGTTATATAAACTTGAATATGAAAGAGTATGCACGAATCTACTGTGTATGCTCTGTAAATATATACTGACGAACAATAGCATCGCTATATAGATA
TGCAGTATTTTTATGAATTACATAAATGTTGAATCTTGATGGACGGCTAATTAGCTTTTAATGTATTGCCTAATGCAGTGTGTGATTGAGAAAGAAAACAACTTCAAGCAGCCAGGAGAG
AGATACAGATCCTTTTCTCCAGACAG
GTATATGTTGTGCTTTGAATTGTTTGTAGTTTTGTAAATCAACTAACATGTTTTTAATCTTTTTCTTTCTTTACAGGCAAGAACGATTCATTAA
CAGAGTTGTGGGTGGTTTGTCTGACCCGCGTGTCACCCATGAGGTCCGCTCAATATGGGTTTCATACTGGTCCCAG
GTCCGATCTTCTTTCCTTAATCTCACACAATTACATATAACGAT
TGACTGACTGATATATGACTTGATTGTTTTTGCAGGCTGACAAGTCTCTGGGACAGAAGATAGCTTCCCGCTTGAATGTGAAGCCAAATTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATCCTTACAAGTACCGTTCTTCAAGTGCCTACAATGCCCCATTCTGGACCACCAATTCCGGTGCTCCGGTTTACAACAACAACAACTCATTGACCGTCGGAAGCAGAGGTCCAATCC
TTCTAGAAGATTACCATTTGGTGGAGAAGCTAGCTAACTTCGACCGTGAGCGTATCCCTGAACGTGTCGTTCATGCCAGAGGTGCCAGTGCTAAGGGATTTTTTGAAGTCACACATGACA
TTACTGCCCTCACATGTGCTGATTTTCTCCGTGCCCCCGGTGTCCAGACTCCTGTTATCGTTCGTTTCTCTACTGTTATCCATGAACGTGGTAGCCCCGAAACCCTCAGGGACCCTAGAG
GTTTCGCAGTGAAGTTCTACACCCGAGAG
GGTAACTTTGATTTGGTGGGAAACAATTTCCCGGTGTTCTTTATTCGTGATGGAATGAAATTTCCCGACATGGTTCACTCGTTGAAACCAA
ACCCTAAATCGCACATTCAAGAAGACTGGAGAATCATGGACTTTTTCTCTCACCATCCCGAGAGTTTGCACATGTTCACATTTCTTCTAGACGATATCGGTGTGCCACAAGATTACCGCC
ACATGGACGGATCCGGTGTCAACACCTACACTTTGATCAACAAAGCTGGAAAAGCATATTACGTGAAGTTCCACTGGAAACCAACATGTGGCGTAAAAAGTTTGTTGGAAGAAGAAGCCA
TCAAGATCGGTGGAGCGAATCACAGCCATGCTACACAAGATCTTTACGATTCGATTGCTGCTGGAAACTACCCCGAGTGGAAGCTTTTTATCCAGACCATTGATCCGGATCACGAGGATC
GGCTCGACTTTGACCCGCTTGATGTTACCAAGACCTGGCCTGAGGATATCTTTCCGTTGCAGCCTGTGGGTCGTCTGGTTTTGAACAAGAATATTGACAACTTCTTTGCTGAGAATGAAC
AGCTGGCATTTTGTCCTGCTATCATTGTTCCTGGAATCTATTATTCTGATGATAAGTTGCTGCAAACCCGTATTTTCTCGTATTCTGACACTCAGAGGCACCGTCTTGGACCGAACTATT
TGCAGCTTCCTGCAAATGCTCCTAAGTGTGCTCATCATAATAATCACTATGATGGATTCATGAATTTCATGCACAGAGATGAGGAG
ATCGATTACTTCCCTTCAAGATATGATCCCGCTC
GTCATGCTGAGCAGTACCCTATTCCTCCTGTTAGGTTGTCCGGAAAGCGTGATAAG
TGTGTGATTGAGAAAGAAAACAACTTCAAGCAGCCAGGAGAGAGATACAGATCCTTTTCTCCAG
ACAG
GCAAGAACGATTCATTAACAGAGTTGTGGGTGGTTTGTCTGACCCGCGTGTCACCCATGAGGTCCGCTCAATATGGGTTTCATACTGGTCCCAGGCTGACAAGTCTCTGGGACAGA
AGATAGCTTCCCGCTTGAATGTGAAGCCAAATTACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAATATTGGA ACCTTAGGTA ACGATAGTCT CAACGAGTAA TTTTTAGTCA CATACGACCA TGAGATTGAG ATTACCGAAA TTCATCTCGT TAGACGAAAA ATAGGCCATT TTCTCGCGAT  ATGTTGACCC ATGCTAGCAC ACGAAAAATA GAAGATAATT GAGAAAATAA TAATATTAAA AAAAAAAAAC TGCTTATATA AAACTCCATC AACATTCCGT AAAGAGCAAA AAGAGTCTTC  TCCACAAGAA ATCATCACAG ATTTCATAAA CCTTCAAATC CATGGATCCT TACAAGTACC GTTCTTCAAG TGCCTACAAT GCCCCATTCT GGACCACCAA TTCCGGTGCT CCGGTTTACA  ACAACAACAA CTCATTGACC GTCGGAAGCA GAGGTCCAAT CCTTCTAGAA GATTACCATT TGGTGGAGAA GCTAGCTAAC TTCGACCGTG AGCGTATCCC TGAACGTGTC GTTCATGCCA  GAGGTGCCAG TGCTAAGGGA TTTTTTGAAG TCACACATGA CATTACTGCC CTCACATGTG CTGATTTTCT CCGTGCCCCC GGTGTCCAGA CTCCTGTTAT CGTTCGTTTC TCTACTGTTA  TCCATGAACG TGGTAGCCCC GAAACCCTCA GGGACCCTAG AGGTTTCGCA GTGAAGTTCT ACACCCGAGA GGGTAACTTT GATTTGGTGG GAAACAATTT CCCGGTGTTC TTTATTCGTG  ATGGAATGAA ATTTCCCGAC ATGGTTCACT CGTTGAAACC AAACCCTAAA TCGCACATTC AAGAAGACTG GAGAATCATG GACTTTTTCT CTCACCATCC CGAGAGTTTG CACATGTTCA  CATTTCTTCT AGACGATATC GGTGTGCCAC AAGATTACCG CCACATGGAC GGATCCGGTG TCAACACCTA CACTTTGATC AACAAAGCTG GAAAAGCATA TTACGTGAAG TTCCACTGGA  AACCAACATG TGGCGTAAAA AGTTTGTTGG AAGAAGAAGC CATCAAGATC GGTGGAGCGA ATCACAGCCA TGCTACACAA GATCTTTACG ATTCGATTGC TGCTGGAAAC TACCCCGAGT  GGAAGCTTTT TATCCAGACC ATTGATCCGG ATCACGAGGA TCGGCTCGAC TTTGACCCGC TTGATGTTAC CAAGACCTGG CCTGAGGATA TCTTTCCGTT GCAGCCTGTG GGTCGTCTGG  TTTTGAACAA GAATATTGAC AACTTCTTTG CTGAGAATGA ACAGCTGGCA TTTTGTCCTG CTATCATTGT TCCTGGAATC TATTATTCTG ATGATAAGTT GCTGCAAACC CGTATTTTCT  CGTATTCTGA CACTCAGAGG CACCGTCTTG GACCGAACTA TTTGCAGCTT CCTGCAAATG CTCCTAAGTG TGCTCATCAT AATAATCACT ATGATGGATT CATGAATTTC ATGCACAGAG  ATGAGGAGAT CGATTACTTC CCTTCAAGAT ATGATCCCGC TCGTCATGCT GAGCAGTACC CTATTCCTCC TGTTAGGTTG TCCGGAAAGC GTGATAAGTG TGTGATTGAG AAAGAAAACA  ACTTCAAGCA GCCAGGAGAG AGATACAGAT CCTTTTCTCC AGACAGGCAA GAACGATTCA TTAACAGAGT TGTGGGTGGT TTGTCTGACC CGCGTGTCAC CCATGAGGTC CGCTCAATAT  GGGTTTCATA CTGGTCCCAG GCTGACAAGT CTCTGGGACA GAAGATAGCT TCCCGCTTGA ATGTGAAGCC AAATTACTAA GGGGGAGCGT TCTAAGGACG TGTTGGTTAT TATATCCGTT  GGGCTTTGGT ATACAACGTA GTCTAGAGAA GTTGTCATTT GTGTTATCAA AAGTGGTGTC AAAAATTCAT GAGTCGTTTC TTTTATTGTC GTAATGTCGA AAAACTCGTA TGATGCTACT  TACCGAATAA ATATGCAGTG TCATTAAAAT TTTCGATGAT GGGTTTATGT AATCGGTTAT TAAGTTATAT GTTGATGATT GTCATGCTAA TTAGTGTGGT TTGAACCCTT TTATTTTGTT  GGTGATTTTA GCATGACCGA GAGTATCTGT AGACTTCAGC TAAGTTATAA TACCACTTGG GCGTTGTTTC TTTAGCTCTT AATGGTTTAG ACCTCTACCT CTTACTGGTT CAACACTTAA  TGGTTTAGAC TGTTTGTTTC GCTAGCAGAT GTCTGAATGG TTCAAACATT TGCCTCAGAA TGGTTAAACA TTATACTAGC TCTTAATGGT TTAGAACTTT TACTGGCTCA GCACTTAATG  GTTCAGACCT TTTACTTGTT TAGCACTTAA CCATTCAGAA GTTGCCAAAC AGCTCTTAGT TTAATTGGAT TCACAATGAG AGCATCCATA AATTCTAGTA AAGTTATAAT ACGATTTAGT  TAGGATGTCT ATAAGGGTTG CTTGTATAAA ATGATCCGAA TCCCAGATCT AAATAAAGTT TTAATTTTCA CTTGGTGTGA CACAGCTTAT GATGGTGCAA ATTGTTTTAC CAAGAATGCT 
CATGTAATAT TCGGTGTGGA CTAGGATGAC TATATATGCT CATGATCACC AAAAAAAGGT CATTTTTTCA CTA 

Retrieve as FASTA