Entry information : MtPrx40 (Medtr5g049280.1 [4.0])
Entry ID 409
Creation 2006-02-21 (Christophe Dunand)
Last sequence changes 2014-07-30 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx40 (Medtr5g049280.1 [4.0])
Name (synonym) MtPrx40 (Medtr5g049280.1 [4.0])
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Inducer Glomus versiforme infection
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx40
start..stop
S start..stop
GmPrx111 575 0 1..338 1..337
GmPrx94 572 0 11..338 10..337
AfpPrx21 535 0 27..338 31..342
AcoPrx17 535 0 27..338 31..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21601277..21601510 234 N° 2 21601958..21602149 192 N° 3 21602247..21602412 166 N° 4 21603050..21603474 425
join(21601277..21601510,21601958..21602149,21602247..21602412,21603050..21603474 )


exon

Literature and cross-references MtPrx40 (Medtr5g049280.1 [4.0])
Literature Harrison,M.J. et al., unpublished
DNA ref. Phytozome 12:   chr5 (21601277..21603474)
Cluster/Prediction ref. Phytozome Gene 12:   31087114
Omic ref. Gene atlas:   Mtr.41137.1.S1_at Legoo:   Mtr.41137.1.S1_at
Protein sequence: MtPrx40 (Medtr5g049280.1 [4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (310)
PWM (Da):   %s   37481.59 (34118.8)  
PI (pH):   %s   4.73 (4.63) Peptide Signal:   %s   cut: 29 range:29-338
Sequence 379
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDTPFLFKFVFLHIFLLFGFLGDNRLYASEPQLTLDYYASTCPTVFDIVRKQMECSVLSEPRNAASVVRLHFHDCFIQGCDGSILLDDTYTLKGEKKAATNIHSLKGFEIIDQIKNFVESECPGVVSCADILTIAARDAVILVGGPYWDVPVGRKDSVTASFELANTNLPTPDESLVSIIPKFLYQGLSVTDMVSLVGSHTIGMARCQNFRSRIYGDYESTSVKNPISDNQFNNLKSICPPIGGGDNNITAMDYVTPNLFDNSFYQLLLKGEGVLNSDQEMYSSVFGIETRELVKKYAADSLAFFQQFSDSMVKMGNITNSESFITGEVRKNCRFVNT

Retrieve as FASTA  
Remarks Complete sequence from 8 ESTs and genomic (chromo 5, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATACTCCATTTCTGTTCAAATTTGTTTTTTTACATATTTTTCTTTTGTTTGGCTTTCTTGGTGACAATAGATTGTATGCAAGTGAGCCTCAACTAACACTTGATTACTATGCATCAA
CTTGTCCTACTGTGTTTGATATTGTCAGGAAGCAAATGGAATGTTCGGTGCTTTCTGAACCTCGTAACGCAGCCTCGGTTGTTCGGCTTCACTTCCATGACTGCTTTATTCAG
GTCTCAA
AAACTTGCCTTTTTTCCTTGTAATTATTGCTTCTGTTTTCATGTTGGAAAGAAAAAAGAGTAAATCCTCGACATATTTCCATTTACCACACCGATTCTACTAAAATGTTAGTCATCTTAA
ACATCATCTTCGGGTTTTACAAAATGAATATCTAAGAACCAATGTGGTGATAAAAATACCTTTAATTGAGAGATAAATTTGGAGATAAAATAAAAATTTCAAAATACTAATATGGCTGTG
ATTTTGATTTTTGAAGGACTAATTTAGTAATCAAAATGTTGAATGAAACAAGTTATGTCTGTGTATACTTTGCAATATCAACTTAAGTTTTACTCCAAAAATAGTAAAGCTACATTACAT
GTTCCATTCAAAGTATTAGATGAACCTATTGAGGAGATAAAGAAAATTCGTACTAAAGAAACTTGATTTTATGTGTTCAGGGTTGCGATGGATCGATCTTGCTCGATGATACATACACAC
TTAAAGGTGAAAAGAAAGCAGCTACCAACATCCACTCTTTAAAAGGCTTTGAAATTATCGATCAAATCAAGAACTTTGTTGAATCAGAGTGCCCTGGAGTTGTTTCTTGTGCCGATATTC
TCACAATTGCGGCTAGAGATGCTGTGATTCTG
GTAAAACAAACAATACAATATGTACAACAAAATTCAATCTTTATCTTATATAAGTTATTGGATTTATGATATCTCTTTGTCCTTTGAT
TTCTTGTAGGTTGGTGGACCATACTGGGATGTTCCTGTGGGAAGGAAAGATTCCGTGACTGCAAGTTTTGAACTTGCTAACACCAATCTTCCAACACCTGATGAAAGCCTTGTTTCTATC
ATTCCCAAATTTCTTTATCAAGGCCTATCAGTCACGGATATGGTTTCCCTTGTCG
GTATGTTCTTATGACTGATTTACAACTTAGGACTCAGAGTACTTGCCGAAGAAGCTCATAGTTCT
TGTCTTAATGAGTGAGACAGTGACCTGATCGCTATTAGTTCGAGAAAAAAAAATGGAAAAATGAATGAGTCGTCAAATCTGAACTCATATTCATTTTCCTTTGTTTTTGTTTTTGTAGAA
CAAACATCCATCAGGTCACCGTCTCACATATGAATGAGAACAAGGATCACTGAGTTTCTATTTTCAAGGAGCGGCATTATTCACCATTGGTGTGTTTTGTGTAATTTTAAAGCGTGATTC
ATCGTAAAACCCGCCTTCCTTGATTTATGATCATTCTAGCTAGCATATTAACTAGAGAGAATAGACCTTACACAGATTGTTTTGTACAATTAGTACAACTCTCAGTTTTACCACAATAAT
CCTCATCTCGGCTCAAATGAAATGTACAAAATAACAAACCAAATTGCATTGCATAAATAATAACAATATGAATATTTTGACCATTTCTTCACATTGCCTTGCAATAAAAGTCAATAACTG
GTTTCCTCGTAAGATTCCTAGGTAGTTGTAAAAGTAATTTGTAATAAACGTTGTTGCGTGCTATATAAATTTCCTGATCACAACACATGCAGGATCCCACACCATTGGTATGGCAAGGTG
TCAAAATTTTCGATCAAGAATATATGGAGACTATGAATCAACTTCAGTGAAAAATCCAATCTCAGATAATCAGTTCAACAACCTGAAATCTATTTGTCCACCAATTGGGGGAGGAGACAA
TAACATAACGGCAATGGACTATGTGACGCCTAATCTCTTCGACAATTCTTTCTACCAGTTACTATTAAAAGGCGAGGGAGTTCTTAACTCAGATCAAGAAATGTACTCGAGTGTGTTCGG
AATCGAAACAAGAGAGCTTGTCAAGAAGTATGCAGCAGACTCTCTTGCTTTCTTCCAGCAATTCTCTGATTCCATGGTCAAAATGGGAAATATCACAAATTCAGAAAGCTTCATCACGGG
AGAAGTTAGGAAGAACTGCAGATTTGTTAACACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATACTCCATTTCTGTTCAAATTTGTTTTTTTACATATTTTTCTTTTGTTTGGCTTTCTTGGTGACAATAGATTGTATGCAAGTGAGCCTCAACTAACACTTGATTACTATGCATCAA
CTTGTCCTACTGTGTTTGATATTGTCAGGAAGCAAATGGAATGTTCGGTGCTTTCTGAACCTCGTAACGCAGCCTCGGTTGTTCGGCTTCACTTCCATGACTGCTTTATTCAG
GGTTGCG
ATGGATCGATCTTGCTCGATGATACATACACACTTAAAGGTGAAAAGAAAGCAGCTACCAACATCCACTCTTTAAAAGGCTTTGAAATTATCGATCAAATCAAGAACTTTGTTGAATCAG
AGTGCCCTGGAGTTGTTTCTTGTGCCGATATTCTCACAATTGCGGCTAGAGATGCTGTGATTCTG
GTTGGTGGACCATACTGGGATGTTCCTGTGGGAAGGAAAGATTCCGTGACTGCAA
GTTTTGAACTTGCTAACACCAATCTTCCAACACCTGATGAAAGCCTTGTTTCTATCATTCCCAAATTTCTTTATCAAGGCCTATCAGTCACGGATATGGTTTCCCTTGTCG
GATCCCACA
CCATTGGTATGGCAAGGTGTCAAAATTTTCGATCAAGAATATATGGAGACTATGAATCAACTTCAGTGAAAAATCCAATCTCAGATAATCAGTTCAACAACCTGAAATCTATTTGTCCAC
CAATTGGGGGAGGAGACAATAACATAACGGCAATGGACTATGTGACGCCTAATCTCTTCGACAATTCTTTCTACCAGTTACTATTAAAAGGCGAGGGAGTTCTTAACTCAGATCAAGAAA
TGTACTCGAGTGTGTTCGGAATCGAAACAAGAGAGCTTGTCAAGAAGTATGCAGCAGACTCTCTTGCTTTCTTCCAGCAATTCTCTGATTCCATGGTCAAAATGGGAAATATCACAAATT
CAGAAAGCTTCATCACGGGAGAAGTTAGGAAGAACTGCAGATTTGTTAACACATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATACTC CATTTCTGTT CAAATTTGTT TTTTTACATA TTTTTCTTTT GTTTGGCTTT CTTGGTGACA ATAGATTGTA TGCAAGTGAG CCTCAACTAA CACTTGATTA CTATGCATCA  ACTTGTCCTA CTGTGTTTGA TATTGTCAGG AAGCAAATGG AATGTTCGGT GCTTTCTGAA CCTCGTAACG CAGCCTCGGT TGTTCGGCTT CACTTCCATG ACTGCTTTAT TCAGGGTTGC  GATGGATCGA TCTTGCTCGA TGATACATAC ACACTTAAAG GTGAAAAGAA AGCAGCTACC AACATCCACT CTTTAAAAGG CTTTGAAATT ATCGATCAAA TCAAGAACTT TGTTGAATCA  GAGTGCCCTG GAGTTGTTTC TTGTGCCGAT ATTCTCACAA TTGCGGCTAG AGATGCTGTG ATTCTGGTTG GTGGACCATA CTGGGATGTT CCTGTGGGAA GGAAAGATTC CGTGACTGCA  AGTTTTGAAC TTGCTAACAC CAATCTTCCA ACACCTGATG AAAGCCTTGT TTCTATCATT CCCAAATTTC TTTATCAAGG CCTATCAGTC ACGGATATGG TTTCCCTTGT CGGATCCCAC  ACCATTGGTA TGGCAAGGTG TCAAAATTTT CGATCAAGAA TATATGGAGA CTATGAATCA ACTTCAGTGA AAAATCCAAT CTCAGATAAT CAGTTCAACA ACCTGAAATC TATTTGTCCA  CCAATTGGGG GAGGAGACAA TAACATAACG GCAATGGACT ATGTGACGCC TAATCTCTTC GACAATTCTT TCTACCAGTT ACTATTAAAA GGCGAGGGAG TTCTTAACTC AGATCAAGAA  ATGTACTCGA GTGTGTTCGG AATCGAAACA AGAGAGCTTG TCAAGAAGTA TGCAGCAGAC TCTCTTGCTT TCTTCCAGCA ATTCTCTGAT TCCATGGTCA AAATGGGAAA TATCACAAAT  TCAGAAAGCT TCATCACGGG AGAAGTTAGG AAGAACTGCA GATTTGTTAA CACATAAAAA CTTTCATTTT TTGGATTATG TATTTTATGT TTGTTTCGAC ACATATAGAA CCATTAATTT 
TATGTGTTTC AGTCACTTTC AGCCATAGCT AGTTGATACA ATGATATGTA ACAAATGAAG CAAGCAATTA TATAATGAAC AAATGAAGTA AAATCGACTG ATTTCCTTTT CAT 

Retrieve as FASTA