Entry information : MtPrx81 (Medtr4g029170.1[4.0])
Entry ID 415
Creation 2005-08-11 (Christophe Dunand)
Last sequence changes 2014-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-07-16 (Christophe Dunand)
Peroxidase information: MtPrx81 (Medtr4g029170.1[4.0])
Name (synonym) MtPrx81 (Medtr4g029170.1[4.0])
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots nodules
Inducer Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx81
start..stop
S start..stop
MtPrx49 566 0 1..321 1..321
GmPrx96 478 7e-172 1..321 1..319
GmPrx97 474 2e-170 1..321 1..319
GmPrx128 473 5e-170 1..321 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10062032..10062247 216 N° 2 10061354..10061548 195 N° 3 10060244..10060798 555  
complement(join(10060244..10060798,10061354..10061548,10062032..10062247))


exon

Literature and cross-references MtPrx81 (Medtr4g029170.1[4.0])
Literature Journet,E.P. et al., unpublished
DNA ref. Phytozome 12:   chr4 (10062247..10060244)
Cluster/Prediction ref. Phytozome Gene 12:   31111272
Omic ref. Gene atlas:   Mtr.40970.1.S1_at Legoo:   Mtr.40970.1.S1_at
Other ref. Medicago_jcvi:   23234
Protein sequence: MtPrx81 (Medtr4g029170.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (296)
PWM (Da):   %s   35060.53 (32216.1)  
PI (pH):   %s   8.14 (7.65) Peptide Signal:   %s   cut: 26 range:26-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSHRYFSMFFHAIVLAALATKTFSALTTNYYDYTCPNALSTIRSVVEAAVEKENRMGGSLLRLHFHDCFVNGCDGSILLDSTPSMDSEKNANPNINSARGFEVVDEIKDAVDKACGKPVVSCADILAVAARDSVVALGGPSWKVKLGRRDSKTASRADADSGNIPGPAFSLSQLIKNFDNKGLNEKDLVALSGAHTIGFSRCLLFRDRIYNDKNIDANFAKQLQDICPREGGDSNLAALDCVTPAKFDEAYYMELIKKKGLLHSDQELLNGDYTGSLVRKYRRDTSAFYNDFAKSMIKMGNIKPLTGSQGEIRSNCRRAN*

Retrieve as FASTA  
Remarks Complete sequence from 2 ESTs and genomic (chromo 4, introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCACATAGGTATTTCTCAATGTTCTTCCATGCAATAGTGTTAGCAGCACTTGCAACCAAAACATTTTCAGCACTCACAACAAATTATTATGACTACACATGCCCTAATGCTTTG
AGCACTATTAGAAGTGTTGTTGAAGCTGCAGTTGAAAAAGAGAATCGTATGGGTGGCTCTTTACTACGCTTGCATTTTCATGATTGCTTTGTTAAT
GTAAGATTTATCAATTTAGTCGCT
AAATATTATATTACTACTAGAAAAACTAAAATGAGAACAAACCCTTCTAAAGTTATAAGCAAATTTGTAGATATCCCAATTTTATTTATTTTTTACCAAAGTGAAAATTATTTATAGATT
TTCACTCTATTTACTCCAACAAAATTTAGAGAAGATTTTAAATTTTTGGTCTCTACATTTTCCTTTCTAATTTTCACTTTTTTAGTAGTGTTAACAATTATATTATAATTTAGTTACTAT
TCCAAATCAATCATTAAACAGTTAATAAATTTATTTAATGATTAATTTAGATAATAATGTGATTCATAATTTGAAAATTGGTCAATAAATAAATTGTTACGATAACTATAAAAAAAAAGA
TTTAAATGTGTTGCTAAACAGCAAATTTTTGTAGCTTATATATGTGTTAATATTAATTATTAAGTGATAGTTAATTTTTTAATTTTTATGGTGATTCAGGGTTGTGATGGTTCAATTCTT
CTAGACTCTACACCTTCGATGGACAGTGAAAAAAATGCAAATCCAAATATAAATTCAGCAAGAGGATTTGAAGTTGTTGATGAGATTAAGGATGCTGTTGATAAAGCATGTGGAAAACCA
GTTGTTTCTTGTGCAGACATTTTGGCTGTAGCTGCAAGAGACTCTGTCGTTGCG
GTTAGTAATATTCTACATTTTAATATATATTTTTAATTTTATTTTGAACTAGTCGGTAATTTTAAA
ACAGAATTAGTCATCAAATGAATAAAATAAAGTTTATATATGAAATTTTTTAACTTATCTTTACTCGGTTTAGGTTAACAAGTATACCACCAACTTTGAATATATCAAAATTAAAATGAC
CAAAGTTGTATAACTTGCTAATAAATTTATTTTACTGAGTCGATTTTACTTATTATATTAGTCTTTACTATTTGAATATATCAAAGTGAAGCTACACAAGTTACATGCATGCTACAAATA
TTTTTTTCGTAAACTAATTTCTTTCTTTTGATTGAGTAAACTAATGTATATTTTAGACATAAAAAGAATAATATCACTAGATTATTAAGATTTTTTTATTGATTTACATCTCTTATCATA
TATTTTCTGGTCTTCATTCATTCCATACGTGTATATATTGATTTAGAGATTTTTCAAATCCTACAAAAACTTTTTCAATATCTTACGAAATTTAAATTGAAATTTACTTACAATTATATA
TGGATGCAGTTAGGAGGACCATCATGGAAAGTGAAACTAGGAAGAAGAGACTCAAAGACAGCAAGTCGTGCCGATGCAGATTCAGGCAATATCCCCGGACCAGCATTCAGTCTTTCTCAA
CTCATCAAAAACTTCGACAATAAAGGCCTAAACGAAAAAGACCTCGTTGCCCTATCTGGAGCACACACTATTGGATTTTCGCGCTGTCTTTTATTTAGAGACCGAATCTACAATGACAAA
AACATCGATGCAAACTTCGCAAAACAGCTTCAAGACATTTGTCCCAGAGAAGGCGGAGACTCCAACCTTGCAGCTCTGGACTGTGTTACACCGGCAAAATTCGATGAGGCATATTACATG
GAACTGATTAAAAAGAAAGGGCTTCTTCATTCGGATCAGGAATTATTGAATGGTGATTATACTGGATCGTTGGTTAGAAAGTATAGGCGCGATACAAGTGCTTTCTACAACGACTTTGCG
AAATCTATGATTAAGATGGGAAATATTAAGCCACTTACTGGGAGTCAAGGTGAAATTCGTTCAAATTGCAGGAGAGCCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCACATAGGTATTTCTCAATGTTCTTCCATGCAATAGTGTTAGCAGCACTTGCAACCAAAACATTTTCAGCACTCACAACAAATTATTATGACTACACATGCCCTAATGCTTTG
AGCACTATTAGAAGTGTTGTTGAAGCTGCAGTTGAAAAAGAGAATCGTATGGGTGGCTCTTTACTACGCTTGCATTTTCATGATTGCTTTGTTAAT
GGTTGTGATGGTTCAATTCTTCTA
GACTCTACACCTTCGATGGACAGTGAAAAAAATGCAAATCCAAATATAAATTCAGCAAGAGGATTTGAAGTTGTTGATGAGATTAAGGATGCTGTTGATAAAGCATGTGGAAAACCAGTT
GTTTCTTGTGCAGACATTTTGGCTGTAGCTGCAAGAGACTCTGTCGTTGCG
TTAGGAGGACCATCATGGAAAGTGAAACTAGGAAGAAGAGACTCAAAGACAGCAAGTCGTGCCGATGCA
GATTCAGGCAATATCCCCGGACCAGCATTCAGTCTTTCTCAACTCATCAAAAACTTCGACAATAAAGGCCTAAACGAAAAAGACCTCGTTGCCCTATCTGGAGCACACACTATTGGATTT
TCGCGCTGTCTTTTATTTAGAGACCGAATCTACAATGACAAAAACATCGATGCAAACTTCGCAAAACAGCTTCAAGACATTTGTCCCAGAGAAGGCGGAGACTCCAACCTTGCAGCTCTG
GACTGTGTTACACCGGCAAAATTCGATGAGGCATATTACATGGAACTGATTAAAAAGAAAGGGCTTCTTCATTCGGATCAGGAATTATTGAATGGTGATTATACTGGATCGTTGGTTAGA
AAGTATAGGCGCGATACAAGTGCTTTCTACAACGACTTTGCGAAATCTATGATTAAGATGGGAAATATTAAGCCACTTACTGGGAGTCAAGGTGAAATTCGTTCAAATTGCAGGAGAGCC
AATTAA

Retrieve as FASTA