Entry information : MtPrx45 (Medtr1g022970.1[4.0] / Medtr1g022970.1[3.5] / Medtr1g028830.1[3.0])
Entry ID 4171
Creation 2006-12-22 (Christophe Dunand)
Last sequence changes 2011-12-13 (Christophe Dunand)
Sequence status complete
Reviewer Harold Duruflé
Last annotation changes 2016-06-17 (Harold Duruflé)
Peroxidase information: MtPrx45 (Medtr1g022970.1[4.0] / Medtr1g022970.1[3.5] / Medtr1g028830.1[3.0])
Name (synonym) MtPrx45 (Medtr1g022970.1[4.0] / Medtr1g022970.1[3.5] / Medtr1g028830.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer UV irradiation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx45
start..stop
S start..stop
GmPrx296 612 0 9..347 1..333
GmPrx244 585 0 9..347 1..334
CpapPrx09 510 0 6..347 12..344
TsPrx09 509 0 1..347 1..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7266413..7266685 273 N° 2 7265823..7266014 192 N° 3 7265523..7265688 166 N° 4 7264984..7265396 413
complement(join(7264984..7265396,7265523..7265688,7265823..7266014,7266413..7266 685))


exon

Literature and cross-references MtPrx45 (Medtr1g022970.1[4.0] / Medtr1g022970.1[3.5] / Medtr1g028830.1[3.0])
Literature Lin,S., Dixon,R., May,G., Sumner,L., Gonzales,B., Cook,D., Kim,D. and Roe,B.A. Medicago truncatula BAC Clone mth2-152f22.
DNA ref. Phytozome 12:   chr1 (7266685..7264984)
EST ref. GenBank:   BQ156680 [3' end]
Cluster/Prediction ref. Phytozome Gene 12:   31099424
Omic ref. Gene atlas:   Mtr.8179.1.S1_at Legoo:   Mtr.8179.1.S1_at
Protein sequence: MtPrx45 (Medtr1g022970.1[4.0] / Medtr1g022970.1[3.5] / Medtr1g028830.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (326)
PWM (Da):   %s   37952.45 (35723.2)  
PI (pH):   %s   8.9 (8.73) Peptide Signal:   %s   cut: 22 range:22-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFTKVILLVAAFLSVTLSHAHPVHDFHFGWGGHHGGTTRGMSFGLSPQFYQFSCPQANDIVMSVLEKAIAKDIRIAASLLRLHFHDCFVQGCDASILLDDSATIVSEKNGGPNKNSVRGFEVIDEIKSKLEQACPRTVSCADIVALAAKGSTVLSGGPNWELPLGRRDSKTASLRGSNKNIPPPNATIEGLLTFFKRQGLDEVDLVALSGAHTIGVAKCATFKQRLYNQNGNNQPDSNLEKTFYFGLKSMCPRSGGDNIISPLDFGSPRMFDNTYYKLLLRGKGLLNSDEVLLTGSVKETRDLVKKYEQDESLFFQQFALSMIKLGNLRPLTGFNGEVRKNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 3 introns) and 1 EST. Also found in AC235668.11 (Phytozome redundant prediction).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAATATTCAT TGAGACAAAT CGAACATTTT ATTCACAAAC ATTTGTCTTT ATATAGTACA AAAATATGGT CAAACGAGAT TATGTGAATA GTGCACACGG TCAAATTGTG ACAATTATTT  TGAGATGGAG GGAGTAACAT TTAATTTCGA ACATACAATG TTCTGTAAAA TTCCCAAGAT ATTATTGTAT TTCTGCTAAC ACAACATGCT CTACATTTGT ATAGGAAACT TTATTGCTAA  GATAAAACTA ATCACCAACA TAGCATGTTC TGCATTCAAA TAGGAAACTT TAAATGTTTA TCATCATCAG TATTTCATGA TCAGCGATCT GGTGTCAGTT CTGCTATTTT TCCGAGGAAT  CAAATCAAAA GAATAACAAA ATGGATAATA AAATTTTACT GTCACCTTGT CCTTATTTAT CAAGGGGACT GTTGATATAT AGTAATAATT GGATGAAATG AACACCATTG ACAGGAAAAG  CTTTTGTGAT TTGCATTTTG CAATAGAATT AGTTTTTGTT TTGGTCAAGA CGATAGAATT AGTTTTAATA TTCAAATATC AAAACAAGGT TTTTATGTTC AGTCATTCCT CAGTTTCTTT  ACAACGGTAA AATGCTTAAA CTAGGGGCCA TAGAGCTTGG TAAATAAACC TCTTACAAGC TCTTAGATTT TATCTATTAC TTAACACATA TGATTAATTA TGTTGTTTAC TTGTTAAGTA  TATTAAGTTT TGTCAGTAAG TCCTAACTCA ACTTACAAAA ATGTCGAAAT TGTTAGTTTG GACATCATGA TTAGAGTTCA AACCTCAACT CATCCACTTA TGTGTGTGAG TTATAAAGTG  ATTATTATCA TTGCGTCTAT CTAAAAAAAA AAAGTATATT AAGTTTATTT GACTATATGA TTTTCTACAT AGAACAATTG ATTGAATTGA ACACATCCCT CAAAGATTGG TCCATTTTGT  TATTTATTTT CCTAAATCAC TAAATTGCAT TCTAGCTTTA ACTTTTCATA CGACCAAGTC ATAAATCACA TAACCGTATG AGCTATGAGG TTGATAAATT CACACATTGC CTGTATCACT  ACATAGTGTG TTCACATTCT ACTTATTCTT TATGTGGAAT GCTACTCATC TTCCTTTCTT GCATCTCAAG TAGAAAACCA CAAAAAGAAC AAAATGTTAA TCTTTAAACA TAACTATCTA  ACGCGGTGTC TCTGCAGGTA CATGAAAGTA CTTTCAATTT TCAGATCTTC AACACGTAAA AGGCCTTTAG AGATCAATCC CATGCGTCAG CTAGAGAAGA AAATATGCTT CTACTGCTTC  ATTAATAATG AAACAATATA ATAGTATTAA TAGTAACCCT TAGATCATGG AAATCATTTG ACTTTAATCA AATCTAACTA AAAGTTCATG CATGCTGATT CAAAAAAAAA GATAGCGTAA  AAACTAAAAA AGTTTTACAC TGACAGTCGA TGAAAATTAA TATCATTAGA CCATATGGTA ATATGATAAA AGACATGGTA AATTAGATAA TGTGATAAAG ATTAGCTTCA AAATGAAGTG  TGTAAAAGTG CAGTGTCTGT TACATTCAAA ATCAAGGAAA CATATTTTAC CCACTTCATA CTTTGTCATA AACATGAACA AATGTATTAC AATCTCAGTC TTTGAACAAA TGTTACAACG  TTGCACTGCA CTTGACCCTT TAACTTAAAC TAGTATTTGG AATCAAATCC TTTTAAGCAA ATCAGTTATA CACTGTTTTG ATAAGGTCCA GGAGCAGGTA AACCAGAACC ACTACATATT  GCATCATAGG TGGGGCTAGG ACAGAACATG TTGATAAAGT CATAAGTTTA CTACTTGCAT ACATTAGGTG ATTAATTTGT TGAAGATAGT AGTGAGTGGT TTGATCCTTT AGCATTATAT 
ATACCAAACA ATCCAATCCA ATATGCCACA CAACAATATT AATAATCATC AGACAAGCCT CTTTGCAGTC ACTTGTCACA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAAGCATAGT TTTATATTAT TATTAAGAGT CATTGAGTCT AGGAACCTTC TAATAATTGG AGGGTTAACA CCAAAAAAAT TAAGAGTCAT TGAGTGTTAT GTTTTGTGTT TCTTTTCCTT  AATAACATGG TACTGTGCCT AAGAAGCATG GTACTAAATA TATTTATTTA AGAAGTACAA CTATATATGT GCTGAAAAAA AAGTACAACT ATATGTTTTG TATTATTTCC TTTTTGAAAT  GTAGAAGGAG GGAAGACTTT AGAAGTATTA AACCTATGGT TGTTATGAGG ATTTGAATTG TGTTGCATCT ATATAAACAG TGAAGTTTGA AAGTACGTAG TAATTGAGTG TTTACATTGC  TTCTATGTGT CACTCTTCAA TAAGTTTATT TTACTGTTGG TGGTGTAAAA AAAGAGAGTA TATTTTATTG AATTTTTGAA GTATATTCTA TTGTTGATAG TCTCATTATC ATGAAAAGCT  TATCATGAAC TAAATGGTTG AATGACTCAA GCATGTAATA TTCTTGCCAC AACATATTTG TATAAAAAGC TACTCTACTA CCTTTTTTTT TTGTTTTTGA GAGAAGCTAC TCTACTATTA  TGATGATAAT ATATGATGAA TTGCAATTGT TTAAGAAACT TTTCACTTAG ATAATAACAC AATCGATACT TACTGACACA GCTTAAAACC CGTTAATTAA TAATGCTAAT TTCATGTATC  AATCTATTAT ATCATTATGA TATAATTTTA AAAATACAAA AATTTCAATT CAAAATAAGA ATCAGAAATA GAACTTTTTT AGCTCACTTT ATGGTAAAGA TTAAAATATA AATATAAAGA  AATTTAGAAT ATTAATTTGA AAATAATTTA GGACCCATTT GTCTCAATAT TTTTCAACAA AATATAGAAA TATTTTCTTG AAATTCGTTT ACTTAATAAC TTAAAAATTT ATCCTTTACA 
AAAAAAAAAA AAAAAAAAAC TTAAAAATTT ATCGTTTCAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCACCAAAGTCATTCTTCTTGTAGCAGCTTTTCTCTCAGTTACACTCTCCCATGCTCATCCTGTCCATGATTTCCACTTTGGCTGGGGTGGTCATCATGGTGGAACCACTAGA
GGAATGTCTTTTGGACTTTCTCCTCAATTCTATCAGTTTTCATGCCCTCAAGCTAATGACATTGTCATGTCAGTCTTGGAGAAGGCCATTGCTAAGGATATCAGAATAGCAGCTTCTCTT
CTTCGACTTCACTTCCACGACTGCTTCGTGCAG
GTAAATTTCAAACACAATAGCAATACATGTTCTAAATACTGGTCTGAGTCGCGACATAAAGGTTTTTAAGTCTTTGCATTTGCACCG
GACACATTTGATCGTACTTCGATATAATATCAAGAATTGTGACCGCAAGTAAAACATAAAATAATATCATAATCATGTATCTAAGTCTTCCTGAATACACTTTCTTAATTTGCCAACAAC
TTTTGATAGAAAAAAATAGATTCATTTCATAAGGAATTAATTCTTATTCTTAGTATATAAAATCATGTATCTTTTTGTTGAGCTATTTTGTAGTATATATTGCTTTCCATTTGTTAAATT
TGCTTTGGATTCTTTTGCATGCATATGTCAAGGAGCTGAAAAATTTCTCTTCATTGTACTTTTAACGACAGGGCTGCGATGCATCAATTTTGTTGGACGATAGCGCCACAATTGTCAGTG
AAAAAAATGGTGGACCTAACAAAAATTCCGTTCGAGGTTTTGAAGTGATCGATGAGATCAAATCTAAGTTGGAACAAGCATGTCCTCGTACAGTCTCATGTGCAGATATTGTTGCCCTTG
CTGCTAAGGGATCCACTGTCCTT
GTAAGAAAAAAACATTTTAAGAACAATATGATTAAACCTAGATGTGTGTGTTTGTCTCTATATATATAAGGTAATCTGACACACTAATACAAACATG
CTTAATTTGAAACTTGATCAATATTCTTTTGAAACAGAGTGGAGGACCTAACTGGGAGCTACCATTAGGAAGGAGAGACTCAAAAACAGCAAGTCTAAGGGGCTCAAACAAAAACATTCC
CCCACCAAATGCCACCATTGAAGGTCTCTTAACATTTTTCAAGCGTCAAGGCCTTGATGAAGTAGACCTTGTTGCCCTCTCAG
GTGGAACTTTCAAATTCTTAACCACATTTTCTATTAG
TGTTACATAATATTACTTCTCTGTCTCGTAATAATTGTCACGTTTACACACAAAAATTGTTCTTAAAAGAGCGTCACTTCATAATGTAGGTGCACATACAATTGGTGTGGCAAAATGTGC
AACATTCAAGCAAAGACTATACAACCAAAATGGAAACAACCAACCAGATTCGAATCTAGAAAAAACATTTTACTTTGGTTTGAAATCAATGTGCCCAAGATCAGGTGGTGACAACATTAT
TTCTCCCTTGGACTTTGGTTCCCCAAGAATGTTTGATAATACCTATTACAAACTCTTACTTAGGGGAAAAGGATTGCTTAATTCAGATGAAGTGCTTCTCACAGGAAGTGTTAAGGAGAC
TCGTGACCTGGTGAAGAAATATGAACAAGATGAGAGTCTCTTCTTTCAACAATTTGCCTTGTCTATGATCAAGTTGGGGAACCTTCGTCCTCTCACTGGATTTAATGGTGAAGTTAGAAA
GAATTGTCGTCGAGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCACCAAAGTCATTCTTCTTGTAGCAGCTTTTCTCTCAGTTACACTCTCCCATGCTCATCCTGTCCATGATTTCCACTTTGGCTGGGGTGGTCATCATGGTGGAACCACTAGA
GGAATGTCTTTTGGACTTTCTCCTCAATTCTATCAGTTTTCATGCCCTCAAGCTAATGACATTGTCATGTCAGTCTTGGAGAAGGCCATTGCTAAGGATATCAGAATAGCAGCTTCTCTT
CTTCGACTTCACTTCCACGACTGCTTCGTGCAG
GGCTGCGATGCATCAATTTTGTTGGACGATAGCGCCACAATTGTCAGTGAAAAAAATGGTGGACCTAACAAAAATTCCGTTCGAGGT
TTTGAAGTGATCGATGAGATCAAATCTAAGTTGGAACAAGCATGTCCTCGTACAGTCTCATGTGCAGATATTGTTGCCCTTGCTGCTAAGGGATCCACTGTCCTT
AGTGGAGGACCTAAC
TGGGAGCTACCATTAGGAAGGAGAGACTCAAAAACAGCAAGTCTAAGGGGCTCAAACAAAAACATTCCCCCACCAAATGCCACCATTGAAGGTCTCTTAACATTTTTCAAGCGTCAAGGC
CTTGATGAAGTAGACCTTGTTGCCCTCTCAG
GTGCACATACAATTGGTGTGGCAAAATGTGCAACATTCAAGCAAAGACTATACAACCAAAATGGAAACAACCAACCAGATTCGAATCTA
GAAAAAACATTTTACTTTGGTTTGAAATCAATGTGCCCAAGATCAGGTGGTGACAACATTATTTCTCCCTTGGACTTTGGTTCCCCAAGAATGTTTGATAATACCTATTACAAACTCTTA
CTTAGGGGAAAAGGATTGCTTAATTCAGATGAAGTGCTTCTCACAGGAAGTGTTAAGGAGACTCGTGACCTGGTGAAGAAATATGAACAAGATGAGAGTCTCTTCTTTCAACAATTTGCC
TTGTCTATGATCAAGTTGGGGAACCTTCGTCCTCTCACTGGATTTAATGGTGAAGTTAGAAAGAATTGTCGTCGAGTTAATTAA

Retrieve as FASTA