Entry information : PnoHalPrx02 (SNOG_14625)
Entry ID 4191
Creation 2007-01-29 (Filippo Passardi)
Last sequence changes 2007-01-29 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoHalPrx02 (SNOG_14625)
Name (synonym) PnoHalPrx02 (SNOG_14625)
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoHalPrx02
start..stop
S start..stop
TterHalPrx01 247 1e-82 27..239 39..251
CgHalPrx02 216 2e-70 26..237 22..232
AnHalPrx01 214 5e-70 26..243 30..246
CgHalPrx01 214 1e-69 22..240 22..239
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28660..28759 100 N° 2 28814..29054 241 N° 3 29116..29390 275 N° 4 29444..29574 131
join(28660..28759,28814..29054,29116..29390,29444..29574)


exon

Literature and cross-references PnoHalPrx02 (SNOG_14625)
Literature Hane J.K., Lowe R.G.T., Solomon P.S., Tan K.-C., Schoch C.L., Spatafora J.W., Crous P.W., Kodira C.D., Birren B.W., Galagan J.E., Torriani S.F.F., McDonald B.A., Oliver R.P. Dothideomycete-plant interactions illuminated by genome sequencing and EST analysis of the wheat pathogen Stagonospora nodorum. Plant Cell 19:3347-3368(2007)
Protein ref. UniProtKB:   Q0U0A6
DNA ref. JGI genome:   scaffold_33 (28660..29574)
Protein sequence: PnoHalPrx02 (SNOG_14625)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   248 (229)
PWM (Da):   %s   27286.5 (25277.3)  
PI (pH):   %s   5.27 (4.90) Peptide Signal:   %s   cut: 20 range:20-248
Sequence 289
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRASFIIPVALATLNRAIAQGSVSDWHPAGPGESRGPCPMLNTLANHGFLPREGRNFTLPTVKHALKTGVNVSEEIAELLYNFALTTNPGPNTTTWGLDTLANHNILEHDASLSRSDDYFTHDVISFNATVYNQTRSYWTEDLINIQMVANARLARMLESVQHNPQFALSELAGAFSAGEGAGYMLVFGNKTAKTARRDFVEYFFEHERLPTELGWTTAEAVISRHDLSTFSDDIINATSYEALNSHR

Retrieve as FASTA  
Remarks Complete sequence from Genomic (3 introns) and 2 ESTs (EH392597 and EH392302). Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGCGCATCGTTCATTATTCCTGTTGCTCTCGCCACTTTGAACCGTGCCATTGCGCAGGGCTCTGTATCAGACTGGCACCCAGCTGGGCCGGGAGAATGTACGTGATGAGCCCATTGAC
CCTTTCTAACAACAATTCACTGATCGCTTCTAGCTCGAGGGCCCTGTCCCATGCTGAACACACTGGCAAACCACGGCTTCCTCCCCCGTGAGGGTCGCAACTTCACGCTCCCCACTGTTA
AGCATGCACTCAAGACAGGTGTGAATGTCAGCGAAGAGATCGCAGAGCTGTTGTACAACTTCGCGCTTACAACGAACCCCGGTCCGAACACGACCACGTGGGGGCTTGACACCCTCGCCA
ATCACAACATTCTGGAGCATGATGCTAGTTTGAG
GTGCGAAACTACTCCTCGGGAATACTCGTGAACGTAATACTGACCTGAGACCTTGCTGCAGTCGCTCAGACGACTACTTCACCCAT
GATGTCATCAGCTTCAATGCCACCGTGTACAACCAGACGCGCTCTTACTGGACTGAAGACTTGATCAACATCCAAATGGTCGCCAATGCTCGTCTTGCCCGCATGCTCGAGTCCGTCCAG
CATAATCCACAATTCGCCCTCTCCGAGCTAGCTGGTGCGTTCAGTGCGGGTGAAGGGGCTGGATACATGCTGGTATTTGGCAACAAGACAGCGAAGACAGCAAGGCGGGACTTCGTGGAG
TACTTCTTCG
GTATGTCCTCCTATTCTCGTCTTTCGTTCTTCCAGTGCTAAATATCGAAATAGAACATGAACGCTTGCCAACTGAGCTTGGCTGGACGACTGCAGAGGCAGTCATCAGCC
GCCATGATCTTTCCACCTTCTCAGATGATATTATCAATGCTACATCATACGAAGCATTGAATTCACATCGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGCGCATCGTTCATTATTCCTGTTGCTCTCGCCACTTTGAACCGTGCCATTGCGCAGGGCTCTGTATCAGACTGGCACCCAGCTGGGCCGGGAGAATCTCGAGGGCCCTGTCCCATGC
TGAACACACTGGCAAACCACGGCTTCCTCCCCCGTGAGGGTCGCAACTTCACGCTCCCCACTGTTAAGCATGCACTCAAGACAGGTGTGAATGTCAGCGAAGAGATCGCAGAGCTGTTGT
ACAACTTCGCGCTTACAACGAACCCCGGTCCGAACACGACCACGTGGGGGCTTGACACCCTCGCCAATCACAACATTCTGGAGCATGATGCTAGTTTGAG
TCGCTCAGACGACTACTTCA
CCCATGATGTCATCAGCTTCAATGCCACCGTGTACAACCAGACGCGCTCTTACTGGACTGAAGACTTGATCAACATCCAAATGGTCGCCAATGCTCGTCTTGCCCGCATGCTCGAGTCCG
TCCAGCATAATCCACAATTCGCCCTCTCCGAGCTAGCTGGTGCGTTCAGTGCGGGTGAAGGGGCTGGATACATGCTGGTATTTGGCAACAAGACAGCGAAGACAGCAAGGCGGGACTTCG
TGGAGTACTTCTTCG
AACATGAACGCTTGCCAACTGAGCTTGGCTGGACGACTGCAGAGGCAGTCATCAGCCGCCATGATCTTTCCACCTTCTCAGATGATATTATCAATGCTACATCAT
ACGAAGCATTGAATTCACATCGCTAG

Retrieve as FASTA