Entry information : PnoHalPrx06 (SNOG_05771)
Entry ID 4215
Creation 2007-01-29 (Filippo Passardi)
Last sequence changes 2007-01-29 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoHalPrx06 (SNOG_05771)
Name (synonym) PnoHalPrx06 (SNOG_05771)
Class Haloperoxidase (haem)    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoHalPrx06
start..stop
S start..stop
PnoHalPrx11 130 6e-34 88..395 48..375
PnoHalPrx08 124 1e-31 88..395 87..412
SreHalPrx02 121 8e-31 1..369 1..369
MpiHalPrx01 109 2e-26 1..396 1..391
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 631994..632561 568 N° 2 632610..633397 788  
join(631994..632561,632610..633397)


exon

Literature and cross-references PnoHalPrx06 (SNOG_05771)
Literature Birren B et al. Annotation of the Phaeosphaeria nodorum SN15 genome
Protein ref. UniProtKB:   Q0UR43
DNA ref. JGI genome:   scaffold_8 (631994..633397)
Protein sequence: PnoHalPrx06 (SNOG_05771)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   451 (434)
PWM (Da):   %s   48801.36 (47115.5)  
PI (pH):   %s   5.8 (5.49) Peptide Signal:   %s   cut: 18 range:18-451
Sequence 492
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFTQAAVLAMPALAAAYPGMMGGAGSRQEIEDYLRTEIKREEAEKREAEPQLLNPVGNLLGALGDTVSGLLNSVGEAIVVKSNLRPEPGYEFKAPGPGDSRGPCPGLNLLANYGYLPRDGYVNQGQVLEATARGFNMATDLSLVLTTFAVLGSGDLDGLSFYLGSGKNGIGGLNRHSVVEADVSPNREDYYTGCGDNHHLSSRLVKQMVGLAAQDPKKEFSMNVMAQHYARSATFSKDYNPFLYYFPFPQIVSLGAFAFYPNFFSNGTYGLGGVANYKSIMSIIGAEYDQKTGEFKYVPERWPENWYRRATPYGAVTTLADGFLQIYPRNIIVPGVAQIGTQNFNPRTLLCDVYQGLNSITPLVLGGTEENVAKGVSWALSVLDPLFSKTALGCPDSVISPNVLFPQSQREGGPVNPPRIPSDANTGDNVYYKTYFKNAPMKPQCNPSQN

Retrieve as FASTA  
Remarks Complete sequence from Genomic (1 intron). Very large peptide signal (prediction correct?). Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGTTCACACAAGCCGCCGTACTGGCTATGCCAGCTCTTGCTGCTGCCTACCCTGGAATGATGGGTGGTGCAGGTTCACGCCAGGAAATTGAAGACTACCTCCGTACCGAAATCAAGC
GTGAAGAGGCGGAGAAGCGTGAAGCTGAACCCCAACTTCTCAACCCAGTCGGCAATCTGCTTGGTGCTCTCGGTGACACTGTCTCTGGATTGCTAAATTCTGTCGGCGAGGCCATTGTTG
TCAAGAGCAATTTGCGCCCAGAGCCCGGTTACGAGTTCAAGGCACCTGGCCCTGGCGACTCCCGTGGACCCTGCCCAGGTCTCAACCTTCTTGCAAACTACGGGTACCTTCCTCGCGACG
GTTATGTCAACCAAGGCCAGGTGCTAGAAGCTACCGCACGTGGCTTCAACATGGCGACAGATCTGTCTTTGGTCCTTACCACCTTCGCTGTTTTGGGCAGTGGTGATCTTGATGGATTGT
CATTCTATCTTGGATCTGGAAAGAACGGAATCGGTGGACTAAACCGCCACTCTGTTGTCGAGGCCGATGTATCGCCCAACCGCGAGG
GTAAGTCCATTCCATTCTCAACACCATATCATG
GCTGACAAGCGACAGACTACTACACTGGCTGCGGTGACAACCACCATCTGTCTTCCCGCCTTGTGAAGCAAATGGTTGGTCTTGCTGCGCAGGACCCTAAGAAGGAGTTCAGCATGAATG
TCATGGCTCAACACTACGCCCGCAGCGCGACCTTCTCAAAGGACTACAACCCGTTCTTGTACTACTTCCCCTTCCCCCAGATCGTCAGCTTGGGAGCCTTCGCCTTCTACCCCAACTTCT
TCTCCAACGGCACTTACGGCTTGGGAGGTGTTGCCAACTACAAGTCCATCATGAGCATCATTGGTGCTGAATACGACCAGAAGACTGGGGAGTTCAAGTATGTTCCTGAAAGATGGCCCG
AGAACTGGTACCGCCGTGCGACACCATATGGTGCAGTCACCACACTCGCCGACGGATTTCTGCAAATCTACCCCCGCAACATCATTGTTCCCGGCGTTGCTCAGATTGGCACGCAGAACT
TCAACCCTCGGACCTTGCTTTGCGACGTTTACCAGGGTCTCAACTCCATCACACCCCTCGTGCTCGGAGGCACCGAGGAGAACGTCGCCAAGGGCGTTTCGTGGGCTTTGAGCGTACTTG
ACCCGCTGTTCAGCAAGACTGCGCTTGGCTGCCCCGATAGCGTAATCTCGCCTAACGTCCTCTTCCCTCAGTCGCAGCGCGAAGGTGGGCCAGTGAACCCACCGAGGATTCCCTCGGACG
CCAACACTGGTGATAACGTCTACTACAAGACGTACTTCAAGAACGCACCCATGAAGCCACAGTGCAACCCTTCTCAGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGTTCACACAAGCCGCCGTACTGGCTATGCCAGCTCTTGCTGCTGCCTACCCTGGAATGATGGGTGGTGCAGGTTCACGCCAGGAAATTGAAGACTACCTCCGTACCGAAATCAAGC
GTGAAGAGGCGGAGAAGCGTGAAGCTGAACCCCAACTTCTCAACCCAGTCGGCAATCTGCTTGGTGCTCTCGGTGACACTGTCTCTGGATTGCTAAATTCTGTCGGCGAGGCCATTGTTG
TCAAGAGCAATTTGCGCCCAGAGCCCGGTTACGAGTTCAAGGCACCTGGCCCTGGCGACTCCCGTGGACCCTGCCCAGGTCTCAACCTTCTTGCAAACTACGGGTACCTTCCTCGCGACG
GTTATGTCAACCAAGGCCAGGTGCTAGAAGCTACCGCACGTGGCTTCAACATGGCGACAGATCTGTCTTTGGTCCTTACCACCTTCGCTGTTTTGGGCAGTGGTGATCTTGATGGATTGT
CATTCTATCTTGGATCTGGAAAGAACGGAATCGGTGGACTAAACCGCCACTCTGTTGTCGAGGCCGATGTATCGCCCAACCGCGAGG
ACTACTACACTGGCTGCGGTGACAACCACCATC
TGTCTTCCCGCCTTGTGAAGCAAATGGTTGGTCTTGCTGCGCAGGACCCTAAGAAGGAGTTCAGCATGAATGTCATGGCTCAACACTACGCCCGCAGCGCGACCTTCTCAAAGGACTACA
ACCCGTTCTTGTACTACTTCCCCTTCCCCCAGATCGTCAGCTTGGGAGCCTTCGCCTTCTACCCCAACTTCTTCTCCAACGGCACTTACGGCTTGGGAGGTGTTGCCAACTACAAGTCCA
TCATGAGCATCATTGGTGCTGAATACGACCAGAAGACTGGGGAGTTCAAGTATGTTCCTGAAAGATGGCCCGAGAACTGGTACCGCCGTGCGACACCATATGGTGCAGTCACCACACTCG
CCGACGGATTTCTGCAAATCTACCCCCGCAACATCATTGTTCCCGGCGTTGCTCAGATTGGCACGCAGAACTTCAACCCTCGGACCTTGCTTTGCGACGTTTACCAGGGTCTCAACTCCA
TCACACCCCTCGTGCTCGGAGGCACCGAGGAGAACGTCGCCAAGGGCGTTTCGTGGGCTTTGAGCGTACTTGACCCGCTGTTCAGCAAGACTGCGCTTGGCTGCCCCGATAGCGTAATCT
CGCCTAACGTCCTCTTCCCTCAGTCGCAGCGCGAAGGTGGGCCAGTGAACCCACCGAGGATTCCCTCGGACGCCAACACTGGTGATAACGTCTACTACAAGACGTACTTCAAGAACGCAC
CCATGAAGCCACAGTGCAACCCTTCTCAGAACTAA

Retrieve as FASTA