Entry information : AbHalPrx01_bisporus (AbHTPx1)
Entry ID 4224
Creation 2007-01-23 (Filippo Passardi)
Last sequence changes 2010-08-16 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-10-25 (Marcel Zamocky)
Peroxidase information: AbHalPrx01_bisporus (AbHTPx1)
Name (synonym) AbHalPrx01_bisporus (AbHTPx1)
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx01_bisporus
start..stop
S start..stop
LbiHalPrx01 368 2e-129 1..280 1..282
CcinHalPrx01 365 6e-128 14..282 13..281
CcinHalPrx02 362 4e-127 1..272 1..272
SlutHalPrx05 345 2e-120 8..282 11..282
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 458140..458353 214 N° 2 457867..458073 207 N° 3 457591..457804 214 N° 4 457309..457523 215
N° 5 457249..457253 5  
complement(join(457249..457253,457309..457523,457591..457804,457867..458073,4581 40..458353))


exon

Literature and cross-references AbHalPrx01_bisporus (AbHTPx1)
Literature Morales-Almora,P. and Thurston,C.F. Molecular analysis of the cellulolytic genes in Agaricus bisporus. Unpublished
Protein ref. UniProtKB:   Q9HGX3
DNA ref. JGI genome:   scaffold_10 (458353..457249)
mRNA ref. GenBank:   AJ293759
Protein sequence: AbHalPrx01_bisporus (AbHTPx1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   284
PWM (Da):   %s   32128.27  
PI (pH):   %s   9.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFILFKIFHDIAFFSWDLGLTFVNLVLPNRPVGKVTPEGHPGYGGKWPEYIPPKEGDSRCSCPALNAMANHGILPRDGKNIQFKEMGRLIRTTYNFSSSFCYFVPHYAAEKVVKKDYNKDTFNLDELDHHNGIEHDASLCREDSALCPDQSKPHVEYITQLLAHATGKDKDGNPLLTMKDLAKYSSKRRADARSYNKKFTLGFIHRMFGSSNSSTMLTIFGGRVKDLETVLLEERLPENWESRVRGKMGLTFAAFNLTVTPVELMISEKKYLKEKAAKEANKD

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and mRNA. strain="D649".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCATCCTTTTCAAGATTTTTCACGACATCGCCTTCTTTTCATGGGACCTCGGTCTGACTTTTGTAAACCTCGTCCTTCCGAACAGGCCAGTGGGGAAGGTTACGCCAGAGGGTCAT
CCCGGGTATGGTGGAAAATGGCCTGAATATATTCCTCCAAAGGAGGGTGATAGCAGATGCTCATGTCCGGCATTGAACGCTATGGCGAATCATG
GTGAGATCTCCCTTGTAAAATAAAAA
AAGACTTCATGTGTGATTTTAACACACATTGTTAACCTAGGTATACTCCCTCGTGACGGCAAAAACATCCAGTTCAAAGAGATGGGCAGACTTATCAGGACCACCTACAACTTTTCTTCG
AGTTTCTGCTACTTCGTACCCCACTACGCCGCCGAAAAAGTAGTGAAGAAGGATTATAACAAAGACACGTTTAATCTTGACGAACTTGATCATCACAATGGTATAGAGCATGACGCTTCT
CTCTGTC
GTAAGTTCATCATCTTGTTTAAACAAATTCGGCAGCCAACTAACTCGCCCCTTGTTCACCAGGCGAAGATAGCGCCCTCTGTCCCGATCAAAGCAAGCCTCATGTCGAATACA
TCACGCAACTTCTTGCACACGCCACAGGCAAGGACAAAGATGGCAATCCTCTCCTCACCATGAAGGATCTTGCAAAGTACTCATCCAAACGTCGCGCTGATGCCCGAAGCTATAATAAGA
AATTCACTCTCGGCTTTATTCATCGCATGTTTGGAAGTTCCAA
GTGAGTCATCTGTCGATAATCAGTTTTACTAGGACTGACAAATGATGTGATGTACGTGATATATCAGCTCATCCACT
ATGCTGACCATTTTCGGTGGACGTGTCAAAGATCTTGAAACTGTCTTACTTGAAGAACGACTTCCCGAGAATTGGGAATCGAGGGTTCGGGGAAAGATGGGCTTGACATTCGCGGCATTC
AATCTCACAGTGACACCGGTCGAGCTTATGATCAGTGAAAAGAAATATCTTAAAGAAAAGGCTGCCAAGGAAGCCAACAAAGACG
GTGCTTCTGCTGTCCCGAACCCTGATATACCATGA
AACTGATTTAATGTCATGAGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCATCCTTTTCAAGATTTTTCACGACATCGCCTTCTTTTCATGGGACCTCGGTCTGACTTTTGTAAACCTCGTCCTTCCGAACAGGCCAGTGGGGAAGGTTACGCCAGAGGGTCAT
CCCGGGTATGGTGGAAAATGGCCTGAATATATTCCTCCAAAGGAGGGTGATAGCAGATGCTCATGTCCGGCATTGAACGCTATGGCGAATCATG
GTATACTCCCTCGTGACGGCAAAAAC
ATCCAGTTCAAAGAGATGGGCAGACTTATCAGGACCACCTACAACTTTTCTTCGAGTTTCTGCTACTTCGTACCCCACTACGCCGCCGAAAAAGTAGTGAAGAAGGATTATAACAAAGAC
ACGTTTAATCTTGACGAACTTGATCATCACAATGGTATAGAGCATGACGCTTCTCTCTGTC
GCGAAGATAGCGCCCTCTGTCCCGATCAAAGCAAGCCTCATGTCGAATACATCACGCAA
CTTCTTGCACACGCCACAGGCAAGGACAAAGATGGCAATCCTCTCCTCACCATGAAGGATCTTGCAAAGTACTCATCCAAACGTCGCGCTGATGCCCGAAGCTATAATAAGAAATTCACT
CTCGGCTTTATTCATCGCATGTTTGGAAGTTCCAA
CTCATCCACTATGCTGACCATTTTCGGTGGACGTGTCAAAGATCTTGAAACTGTCTTACTTGAAGAACGACTTCCCGAGAATTGG
GAATCGAGGGTTCGGGGAAAGATGGGCTTGACATTCGCGGCATTCAATCTCACAGTGACACCGGTCGAGCTTATGATCAGTGAAAAGAAATATCTTAAAGAAAAGGCTGCCAAGGAAGCC
AACAAAGACG
ATTAA

Retrieve as FASTA