Entry information : PnoHalPrx08
Entry ID 4225
Creation 2007-01-29 (Filippo Passardi)
Last sequence changes 2007-01-29 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoHalPrx08
Name PnoHalPrx08
Class Haloperoxidase (haem)    [Orthogroup: HalPrx002]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoHalPrx08
start..stop
S start..stop
PnoHalPrx11 431 8e-151 77..416 38..379
PanHalPrx01 305 2e-101 46..414 14..383
PnoHalPrx09 147 3e-40 88..403 78..389
PnoHalPrx13 129 2e-33 80..421 56..414
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 548436..549190 755 N° 2 549322..549832 511  
join(548436..549190,549322..549832)


exon

Literature and cross-references PnoHalPrx08
Literature Birren B. et al.
Annotation of the Phaeosphaeria nodorum SN15 genome
unpublished
DNA sequence http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62361755&itemID=260&view=gbwithparts
Protein ref. GenPept:   111066303 UniProtKB:   Q0UT82
DNA ref. JGI genome:   scaffold_7 (548436..549832)
Protein sequence: PnoHalPrx08
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   421 (403)
PWM (Da):   %s   44577.1 (42735.2)  
PI (pH):   %s   5.62 (5.37) Peptide Signal:   %s   cut: 19 range:19-421
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHTLSSLLVLSSATSAWGYGWVASQAGVDSSLLREARYANNKRQTTCPFNADHKGAAPYTSQYPYTGAKNGVPGSQKGGIKVPADGDTAHYYTAPGPNDIRGPCPGLNAAANHNFLSHDGVTNFNELVDAQQNVYNVGYDLSVLLAVLGIQADGDIVTTKLSIGCDATSRTALLPLLGRQPGLNGHNKFEGDSSLTRTDYFLNNGDNYSFNGSLFAEMKSFADTVSGGKFDLDALAAYRGKRYDESLATNGKPLSLLLYGAASFLYELFPSYGDKGVADLATMKSFFGAVEDANAPGGWAHVPERIPENWFSRVAPYTNNDVVQQILAMYLKAPKLFGGNIGVNNFDGLGTFGKIQGGELPNDATAGDVLCLLYQLATMAVPSSLSTVTDITAAALNFSVGKLNPVFKNQGCALKPDQTQG

Retrieve as FASTA  
Remarks Complete sequence from Genomic. Strain="SN15". 2 exons.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATACTCTCTCATCTCTTCTCGTTCTCTCTTCTGCCACCAGTGCTTGGGGCTATGGTTGGGTTGCCAGTCAAGCTGGCGTAGATTCCTCCCTGCTGAGAGAAGCTCGGTACGCCAAC
AACAAGCGTCAGACAACTTGCCCCTTCAACGCAGACCATAAGGGTGCCGCGCCCTACACATCTCAATACCCATACACAGGAGCGAAGAATGGTGTTCCTGGATCGCAAAAGGGCGGCATC
AAGGTGCCAGCCGATGGCGACACTGCCCATTACTACACTGCTCCAGGACCGAACGACATCCGAGGACCTTGCCCAGGCTTGAACGCCGCAGCAAACCACAATTTCTTGTCTCACGACGGA
GTCACCAACTTCAATGAGCTTGTCGATGCTCAACAGAACGTCTACAACGTTGGCTACGACCTTTCAGTCCTCCTGGCTGTGCTCGGTATCCAAGCCGACGGTGACATTGTCACGACCAAG
CTCAGTATCGGATGCGATGCTACTTCTCGCACTGCGCTGCTGCCACTGCTCGGTCGCCAGCCCGGACTTAATGGACACAACAAATTCGAGGGTGATTCTTCGCTTACCCGTACCGACTAC
TTCCTCAACAATGGCGACAACTACTCTTTCAACGGCTCACTCTTTGCTGAGATGAAGTCATTCGCCGATACTGTCTCGGGCGGTAAATTTGACCTTGATGCGCTTGCTGCATACCGTGGC
AAGCGTTATGACGAATCTCTCGCCACCAACGGTAA
GTCAACCTTCACACCCATCACCACAAAACTTCTCTAGGCAGTACAGAGGCTAATCAATTCAGGGAATTTCTTCTTTGGGCACGTG
ACACCTTTGCAAGATTAAGTGGAAGTTATTACTAACTTTACTGCAGACCATTGTCCCTCCTCCTTTATGGAGCCGCATCCTTCCTCTACGAACTTTTCCCATCTTACGGCGACAAGGGCG
TAGCCGACCTCGCCACAATGAAAAGCTTCTTCGGCGCCGTAGAAGACGCCAACGCACCCGGCGGCTGGGCCCACGTCCCAGAGCGCATTCCCGAGAACTGGTTCAGCCGTGTCGCTCCCT
ATACCAACAACGACGTCGTGCAACAGATCTTGGCCATGTACCTGAAGGCTCCCAAGCTCTTCGGCGGCAACATCGGCGTCAACAACTTTGACGGCCTCGGTACCTTTGGTAAGATCCAGG
GCGGTGAACTGCCCAACGATGCCACTGCGGGAGACGTGCTGTGTCTGCTGTACCAGCTGGCTACCATGGCTGTGCCGTCGAGCTTGAGCACTGTCACGGACATTACGGCTGCGGCGCTGA
ACTTCAGTGTTGGGAAGCTCAACCCTGTGTTTAAGAACCAGGGATGCGCGTTGAAGCCGGACCAGACTCAGGGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATACTCTCTCATCTCTTCTCGTTCTCTCTTCTGCCACCAGTGCTTGGGGCTATGGTTGGGTTGCCAGTCAAGCTGGCGTAGATTCCTCCCTGCTGAGAGAAGCTCGGTACGCCAAC
AACAAGCGTCAGACAACTTGCCCCTTCAACGCAGACCATAAGGGTGCCGCGCCCTACACATCTCAATACCCATACACAGGAGCGAAGAATGGTGTTCCTGGATCGCAAAAGGGCGGCATC
AAGGTGCCAGCCGATGGCGACACTGCCCATTACTACACTGCTCCAGGACCGAACGACATCCGAGGACCTTGCCCAGGCTTGAACGCCGCAGCAAACCACAATTTCTTGTCTCACGACGGA
GTCACCAACTTCAATGAGCTTGTCGATGCTCAACAGAACGTCTACAACGTTGGCTACGACCTTTCAGTCCTCCTGGCTGTGCTCGGTATCCAAGCCGACGGTGACATTGTCACGACCAAG
CTCAGTATCGGATGCGATGCTACTTCTCGCACTGCGCTGCTGCCACTGCTCGGTCGCCAGCCCGGACTTAATGGACACAACAAATTCGAGGGTGATTCTTCGCTTACCCGTACCGACTAC
TTCCTCAACAATGGCGACAACTACTCTTTCAACGGCTCACTCTTTGCTGAGATGAAGTCATTCGCCGATACTGTCTCGGGCGGTAAATTTGACCTTGATGCGCTTGCTGCATACCGTGGC
AAGCGTTATGACGAATCTCTCGCCACCAACGGTAA
ACCATTGTCCCTCCTCCTTTATGGAGCCGCATCCTTCCTCTACGAACTTTTCCCATCTTACGGCGACAAGGGCGTAGCCGACCTC
GCCACAATGAAAAGCTTCTTCGGCGCCGTAGAAGACGCCAACGCACCCGGCGGCTGGGCCCACGTCCCAGAGCGCATTCCCGAGAACTGGTTCAGCCGTGTCGCTCCCTATACCAACAAC
GACGTCGTGCAACAGATCTTGGCCATGTACCTGAAGGCTCCCAAGCTCTTCGGCGGCAACATCGGCGTCAACAACTTTGACGGCCTCGGTACCTTTGGTAAGATCCAGGGCGGTGAACTG
CCCAACGATGCCACTGCGGGAGACGTGCTGTGTCTGCTGTACCAGCTGGCTACCATGGCTGTGCCGTCGAGCTTGAGCACTGTCACGGACATTACGGCTGCGGCGCTGAACTTCAGTGTT
GGGAAGCTCAACCCTGTGTTTAAGAACCAGGGATGCGCGTTGAAGCCGGACCAGACTCAGGGCTAG

Retrieve as FASTA