Entry information : GmPrx10 (Glyma06g45910.1 / PC7)
Entry ID 423
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-10-10 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx10 (Glyma06g45910.1 / PC7)
Name (synonym) GmPrx10 (Glyma06g45910.1 / PC7)
Class Class III peroxidase    [Orthogroup: Prx135]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Hypocotyls
Roots
Inducers Cyst nematode infection
Pathogen interaction
Phytophthora infection
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx10
start..stop
S start..stop
GmPrx45 632 0 1..324 1..324
PvPrx12 589 0 1..324 1..325
GmPrx162 565 0 1..324 1..325
MtPrx53 550 0 1..323 3..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48637410..48637619 210 N° 2 48637105..48637296 192 N° 3 48636059..48636221 163 N° 4 48635024..48635433 410
complement(join(48635024..48635433,48636059..48636221,48637105..48637296,4863741 0..48637619))


exon

Literature and cross-references GmPrx10 (Glyma06g45910.1 / PC7)
Literature Chen,W. and Atherly,A.G, unpublished.
Protein ref. UniProtKB:   Q9ZTW8 [Incorrect prediction]
DNA ref. Phytozome 12:   Gm06 (48637619..48635024)
Cluster/Prediction ref. UniGene:   Gma.320
Protein sequence: GmPrx10 (Glyma06g45910.1 / PC7)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324
PWM (Da):   %s   35129.04  
PI (pH):   %s   8.16
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSQSYFKALIICLIALIGSTQAQLQLGFYAKSCPKAEQIILKYVVEHIHNAPSLAAALIRLHFHDCFVNGCDGSVLVDSTPGNQAEKDAIPNLTLRGFGFIEAIKRLVEAECPGVVSCADILALTARDSIHATGGPYWNVPTGRRDGFISRAADPLRSLPAPFHNLTTQLTLFGNVGLDANDLVLLVGAHTIGIAHCSSISTRLYNFTGKGDTDPTIDNGYAKNLKTFKCKNINDNSLIEMDPGSRDTFDLGYYKQVVKRRGLFQSDAELLTSPITRSIIASQLQSTQGFFAEFAKSMEKMGRINVKLGSEGEIRKHCARVNN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 35 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGCCAGAGTTACTTCAAGGCTTTGATTATTTGCCTTATAGCACTAATTGGATCAACTCAAGCTCAATTGCAGCTTGGTTTCTATGCCAAAAGTTGTCCAAAGGCTGAGCAAATA
ATTCTGAAGTACGTTGTTGAGCATATCCACAACGCTCCATCACTAGCAGCTGCTCTCATAAGATTGCACTTCCATGATTGTTTTGTCAAT
GTATGCACATATTTATGGTTTCATTTTCTA
GTTAATTGATGACTATTTTGTTAAACTGATGAGGAGGTAACATTAATTAACGTGTAGTGTATATATATTAATATTAATTTCAGGGTTGTGATGGATCAGTGCTTGTGGACTCAACACCAG
GGAATCAAGCTGAAAAGGACGCTATTCCAAATCTTACACTCCGAGGCTTTGGCTTCATTGAAGCAATAAAGAGGCTTGTTGAAGCTGAATGCCCTGGTGTAGTCTCTTGTGCTGATATCT
TGGCTTTGACTGCCAGAGACTCTATTCATGCCACT
GTAAGTACTTACTTCATCTTTTAAACTCTCAATTAATTGAAAGAATTTTATAATTAAGAATATAATAAATAATAGTTAAATTTAA
TCTTATTTGTATGGAAAATTCATATTGTGTTGTACTTCTGTTGAAAATTTTACTATATGTACTTCACAAATAGTTTGAATATCCCAAACTTTATATTTTTTTTGTTGTCCTTTTTCTACC
AATCTTCATCACAAACCACTTACATGGCTCCGTCAAGCATTGTAGTATAAGTATTTTTGTGACGTAGAGTTGCAATATGACGACTCTTGATGGAGTTATATTAGCGTTTTGTAAAGAAAT
GACTAAGAATGAAAGGTTATTTCATCACATATATCATAAACGGAAAACTAATTACATAAGTAATTATATAAATTAAAAGCAAAAATCAAGATATTTACTAGGATGAAAAATATATTTAAA
TTGAGATAAACTATAACACCTTTTAATATTTATAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTTATAATAACAATTTTT
TTTATTTTTAAAACATCATTTTTTTCCCTTTTAATTTGTTATATCAATATCATATGCTATATTAGTGGCCATATAATTTTAAAAATTTATTCTGTCCTTAAAATTGTCCATGTTGCATTA
AATTCGTGTTTGTGTGTTACAAACTAGGGTTGGCCTGATGGTAGAAGTTAGAATAGATGCATGAAATTTAAGTTTGACTTTCATTATCATCATTCTAAAAAAAAAACTCATGTTTCTGCT
ATGTTTTCTCTATGCTTTCTTATATAGAATAGAAATGAGTCAGATTCTTGTTTTGTGATGATTGAGATGGGTTTGCAGGGTGGACCCTATTGGAATGTTCCAACAGGACGAAGGGATGGG
TTCATCTCTAGAGCAGCAGATCCGTTACGCAGCCTTCCTGCTCCTTTTCACAACCTCACTACCCAACTAACACTCTTTGGCAATGTTGGACTTGATGCAAATGACCTTGTCTTGCTTGTT
G
GTATGTTAAACACAAGTTGCATGATAAAAGTTTGCATCAGGCTAGTTGAGAAAACATTTTCTATTTTTTTTCACTTTTAATTATAAAACTGACATTTATTTTTAAATTACTTTTTGTTT
TCTAAAACTTGTACTTCGTCCGTACTCAACTATAAGAAGAAAAAAAAAGTTAGGTGGACTGAAATGTAAATCAATTTCAACTCATTCAACCTTATTTAATTAATGTCATTATTTCAAAAT
ATCCAGGAATTAATTAAAATGTGATTAACATCTTCGATAAATATGATTAAGGATAATTTAAAAAATGCAATTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCAAAAAATTAA
ATAAACTTAGTTAACAACCATAATTAGTGTGAAATTATATATTATTATTTATATTTGAGTTTGAAGGGAGTATAAGAACACATAAAACATAAAAGATTTTTCAAAGTAAATAAGTCCTAA
GTCAATTAAATAAAACTCTCATTGTGATTGAGAATAATACTAGAAACACCAAAAAATTATATACATATATATAAGTTTTTTTTTTCTTTTTTTGTTCTACATTTAAATTTCTCTATCTCT
AATCGCCAAAAATTCAATTCCTTCAGGTGCTCACACAATTGGTATTGCCCATTGTTCATCAATTTCAACCCGTCTATACAATTTCACAGGCAAGGGTGACACAGACCCAACAATAGACAA
TGGATATGCAAAAAATCTCAAGACCTTCAAGTGTAAGAACATTAATGATAACTCACTTATTGAGATGGACCCTGGAAGTCGTGATACATTTGATCTTGGATATTACAAACAAGTGGTTAA
GAGAAGGGGTTTGTTCCAATCAGATGCTGAATTGCTTACTAGTCCTATCACAAGGTCTATTATCGCTAGTCAACTTCAGTCAACTCAAGGATTCTTTGCGGAATTTGCCAAGTCTATGGA
GAAAATGGGACGAATTAATGTCAAGCTTGGATCTGAAGGAGAGATAAGGAAACATTGTGCACGAGTTAATAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGCCAGAGTTACTTCAAGGCTTTGATTATTTGCCTTATAGCACTAATTGGATCAACTCAAGCTCAATTGCAGCTTGGTTTCTATGCCAAAAGTTGTCCAAAGGCTGAGCAAATA
ATTCTGAAGTACGTTGTTGAGCATATCCACAACGCTCCATCACTAGCAGCTGCTCTCATAAGATTGCACTTCCATGATTGTTTTGTCAAT
GGTTGTGATGGATCAGTGCTTGTGGACTCA
ACACCAGGGAATCAAGCTGAAAAGGACGCTATTCCAAATCTTACACTCCGAGGCTTTGGCTTCATTGAAGCAATAAAGAGGCTTGTTGAAGCTGAATGCCCTGGTGTAGTCTCTTGTGCT
GATATCTTGGCTTTGACTGCCAGAGACTCTATTCATGCCACT
GGTGGACCCTATTGGAATGTTCCAACAGGACGAAGGGATGGGTTCATCTCTAGAGCAGCAGATCCGTTACGCAGCCTT
CCTGCTCCTTTTCACAACCTCACTACCCAACTAACACTCTTTGGCAATGTTGGACTTGATGCAAATGACCTTGTCTTGCTTGTTG
GTGCTCACACAATTGGTATTGCCCATTGTTCATCA
ATTTCAACCCGTCTATACAATTTCACAGGCAAGGGTGACACAGACCCAACAATAGACAATGGATATGCAAAAAATCTCAAGACCTTCAAGTGTAAGAACATTAATGATAACTCACTTATT
GAGATGGACCCTGGAAGTCGTGATACATTTGATCTTGGATATTACAAACAAGTGGTTAAGAGAAGGGGTTTGTTCCAATCAGATGCTGAATTGCTTACTAGTCCTATCACAAGGTCTATT
ATCGCTAGTCAACTTCAGTCAACTCAAGGATTCTTTGCGGAATTTGCCAAGTCTATGGAGAAAATGGGACGAATTAATGTCAAGCTTGGATCTGAAGGAGAGATAAGGAAACATTGTGCA
CGAGTTAATAACTAA

Retrieve as FASTA