Entry information : PnoHalPrx11
Entry ID 4235
Creation 2007-01-29 (Filippo Passardi)
Last sequence changes 2007-01-29 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoHalPrx11
Name PnoHalPrx11
Class Haloperoxidase (haem)    [Orthogroup: HalPrx002]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoHalPrx11
start..stop
S start..stop
PnoHalPrx08 431 1e-150 38..379 77..416
PanHalPrx01 276 2e-90 43..378 50..384
PnoHalPrx09 139 8e-38 49..352 78..375
PnoHalPrx10 135 5e-36 49..375 69..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20059..20277 219 N° 2 20324..21247 924  
join(20059..20277,20324..21247)


exon

Literature and cross-references PnoHalPrx11
Literature Birren, B. et al.

Annotation of the Phaeosphaeria nodorum SN15 genome

unpublished
DNA sequence http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62361750&itemID=5&view=gbwithparts
Protein ref. GenPept:   111063033 UniProtKB:   Q0UK37
DNA ref. JGI genome:   scaffold_12 (20059..21247)
Protein sequence: PnoHalPrx11
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   380
PWM (Da):   %s   40610.31  
PI (pH):   %s   6.16
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTEDRLTALSTPITNQPLRTTPASPTPARGTVCQELGKGGIRVPAHGDTAHAFKAPTSKDIRGPCPGLNAAANHNFIARDGITTFNELMDAQQNLWNVNYDLALILAVIGVVQDGDIITGKLSIACDATSRTAALGGLNLLGRQPGLNSHSRFEADASLTRNDYFTHGGDNYSFNGTLFARMKEVADRVSGGNFDQKAMAAYRSQRYDESLAENGNFFWGPLAILLYGASSFVYELFAPYGGQADLASVSSFFGTTQDSNGEWQHTAERIPDGWHNRRYPYTTASGVEQILAQLLAYPKPFGGNIGPNNFNALNFGVIRDGKLPDSATAGDILCLLYQLATSQVPNTLTGVLALPINLVKWSASKLNPVFDNAGCALAPL*

Retrieve as FASTA  
Remarks Complete sequence Genomic. Strain="SN15". 2 exons.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGAAGACAGGCTCACTGCCCTTTCAACGCCAATCACGAACCAGCCGCTCCGTACAACGCCAGCTTCCCCTACACCGGCGCGCGGAACGGTTTGCCAGGAACTCGGGAAAGGCGGT
ATCAGGGTGCCTGCACATGGAGATACGGCACATGCTTTCAAGGCACCGACATCCAAGGACATCCGCGGACCATGTCCAGGCCTCAATGCGGCAGCAAAC
GTGAGAATTCCTGCCAAAATC
GTCGCCACTCAGCTAACAGTATCAGCACAATTTCATAGCACGCGATGGCATCACGACGTTCAACGAGCTCATGGATGCCCAGCAGAATCTGTGGAATGTGAACTACGACCTCGCCCTCAT
CCTTGCTGTGATCGGAGTCGTCCAAGATGGGGACATAATCACAGGAAAGCTGAGCATCGCCTGCGACGCAACGTCCCGCACAGCAGCTCTCGGTGGTCTCAACCTTCTTGGACGGCAGCC
TGGCTTGAACAGTCACAGCAGATTCGAGGCAGATGCGTCGCTTACACGGAACGATTACTTCACCCACGGCGGCGATAACTACTCCTTTAATGGCACACTGTTCGCCCGGATGAAGGAAGT
CGCCGACCGCGTTTCGGGCGGGAACTTTGACCAGAAGGCCATGGCTGCGTACAGAAGCCAGCGCTACGACGAGTCTCTTGCTGAGAATGGCAACTTTTTCTGGGGACCTTTGGCTATATT
GCTTTACGGAGCGTCTTCCTTTGTGTACGAGCTCTTCGCGCCATACGGTGGCCAGGCGGACCTCGCTTCCGTCTCATCGTTCTTCGGCACAACGCAAGACTCAAACGGAGAATGGCAACA
TACAGCCGAGCGCATTCCAGATGGCTGGCACAACCGGAGATATCCATATACAACGGCATCTGGTGTGGAGCAGATTCTAGCCCAGCTCCTTGCTTATCCCAAACCGTTCGGTGGTAATAT
CGGACCGAACAACTTCAACGCTCTAAACTTTGGTGTCATACGGGATGGCAAGTTACCCGATAGCGCAACGGCTGGAGACATCCTTTGTTTATTGTATCAGCTGGCTACGTCTCAGGTTCC
GAATACCCTGACGGGTGTTCTCGCTCTGCCGATAAACTTGGTGAAGTGGTCCGCCAGCAAGCTAAATCCCGTGTTTGATAATGCAGGTTGTGCTCTTGCTCCTCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGAAGACAGGCTCACTGCCCTTTCAACGCCAATCACGAACCAGCCGCTCCGTACAACGCCAGCTTCCCCTACACCGGCGCGCGGAACGGTTTGCCAGGAACTCGGGAAAGGCGGT
ATCAGGGTGCCTGCACATGGAGATACGGCACATGCTTTCAAGGCACCGACATCCAAGGACATCCGCGGACCATGTCCAGGCCTCAATGCGGCAGCAAAC
CACAATTTCATAGCACGCGAT
GGCATCACGACGTTCAACGAGCTCATGGATGCCCAGCAGAATCTGTGGAATGTGAACTACGACCTCGCCCTCATCCTTGCTGTGATCGGAGTCGTCCAAGATGGGGACATAATCACAGGA
AAGCTGAGCATCGCCTGCGACGCAACGTCCCGCACAGCAGCTCTCGGTGGTCTCAACCTTCTTGGACGGCAGCCTGGCTTGAACAGTCACAGCAGATTCGAGGCAGATGCGTCGCTTACA
CGGAACGATTACTTCACCCACGGCGGCGATAACTACTCCTTTAATGGCACACTGTTCGCCCGGATGAAGGAAGTCGCCGACCGCGTTTCGGGCGGGAACTTTGACCAGAAGGCCATGGCT
GCGTACAGAAGCCAGCGCTACGACGAGTCTCTTGCTGAGAATGGCAACTTTTTCTGGGGACCTTTGGCTATATTGCTTTACGGAGCGTCTTCCTTTGTGTACGAGCTCTTCGCGCCATAC
GGTGGCCAGGCGGACCTCGCTTCCGTCTCATCGTTCTTCGGCACAACGCAAGACTCAAACGGAGAATGGCAACATACAGCCGAGCGCATTCCAGATGGCTGGCACAACCGGAGATATCCA
TATACAACGGCATCTGGTGTGGAGCAGATTCTAGCCCAGCTCCTTGCTTATCCCAAACCGTTCGGTGGTAATATCGGACCGAACAACTTCAACGCTCTAAACTTTGGTGTCATACGGGAT
GGCAAGTTACCCGATAGCGCAACGGCTGGAGACATCCTTTGTTTATTGTATCAGCTGGCTACGTCTCAGGTTCCGAATACCCTGACGGGTGTTCTCGCTCTGCCGATAAACTTGGTGAAG
TGGTCCGCCAGCAAGCTAAATCCCGTGTTTGATAATGCAGGTTGTGCTCTTGCTCCTCTCTAG

Retrieve as FASTA