Entry information : GmPrx07 (Glyma08g19170.1)
Entry ID 426
Creation 2007-02-02 (Christophe Dunand)
Last sequence changes 2011-10-07 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx07 (Glyma08g19170.1)
Name (synonym) GmPrx07 (Glyma08g19170.1)
Class Class III peroxidase    [Orthogroup: Prx304]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Etiolated seedlings
Hypocotyls
Leaves
Seedlings
Whole seedlings
Inducers Pathogen interaction
Phytophthora infection
Sudden Death Syndrome disease
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx07
start..stop
S start..stop
LjPrx21 454 1e-162 4..321 3..321
LjPrx07 443 6e-158 1..321 1..326
AhPrx05 438 8e-156 1..321 1..330
GmPrx256 432 1e-153 1..321 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14466507..14466917 411 N° 2 14467023..14467185 163 N° 3 14468031..14468422 392  
join(14466507..14466917,14467023..14467185,14468031..14468422)


exon

Literature and cross-references GmPrx07 (Glyma08g19170.1)
Literature Shoemaker,R et al, Public Soybean EST Project, Tyler, B. Not Published.
DNA ref. Phytozome 12:   Gm08 (14466507..14468422)
Protein sequence: GmPrx07 (Glyma08g19170.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (297)
PWM (Da):   %s   34402.75 (31750.2)  
PI (pH):   %s   9.14 (8.94) Peptide Signal:   %s   cut: 25 range:25-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEGGLWKKELVLRFVVLAVAVVNTVQWNGEGTRVGFYSSTCPRAESIVRSTVESHLRSDPTLAGPILRMHFHDCFVRGCDASVLIAGAGTERTAGPNLSLRGFDVIDDAKAKIEALCPGVVSCADILSLAARDSVVLSGGLSWQVPTGRKDGRVSIGSEALTLPGPNDTVATQKDKFSNKGLNTEDLVILAGGHTIGTSACRSFADRIYNPNGTDPSIDPSFLPFLRQICPQTQPTKRVALDTGSQFKFDTSYFAHLVRGRGILRSDQVLWTDASTRGFVQKYLATGPFKVQFGKSMIKMSNIGVKTGSQGEIRKICSAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 39+3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGGTGGTTTGTGGAAGAAAGAGTTGGTTCTAAGGTTTGTTGTGCTTGCTGTGGCTGTTGTGAACACAGTGCAATGGAATGGAGAAGGCACGCGTGTAGGGTTCTATTCGAGCACA
TGTCCACGTGCCGAGTCCATTGTCAGGTCCACAGTGGAATCCCACCTTAGGTCAGACCCTACTTTAGCTGGTCCAATACTTAGGATGCACTTCCATGATTGCTTTGTGCGAGGTTGTGAC
GCTTCTGTTCTCATAGCCGGTGCTGGCACTGAGAGAACAGCGGGGCCAAACCTTAGTTTGAGAGGATTTGATGTCATTGACGATGCTAAGGCTAAGATCGAGGCTCTGTGCCCTGGTGTT
GTCTCTTGTGCTGATATCCTTAGCCTTGCTGCTCGTGATTCTGTAGTTCTG
GTAATTTTGCTCTTGATATTTATTGAGAAATTTATATATAGATGATAAGGAATAATATTGTACTAGTTA
GTGATCGAGTTATACATATGGGTTGCATGCATGCAGAGTGGTGGACTAAGTTGGCAAGTGCCCACAGGACGCAAAGATGGAAGGGTTTCAATTGGATCAGAAGCCTTAACTTTGCCTGGT
CCTAATGATACCGTCGCAACCCAGAAGGATAAGTTTTCAAACAAGGGCCTTAACACCGAAGACCTCGTCATTCTTGCTG
GTACTCATACTATTCAATTAAACTCCAATAATTTGTTACAA
TTTTCTATTTTTTTATAATTAATTATCAATAATTAGTTTTAAAATAAATTAATCTAAAACACGCAGAAAATCGCTTTCTTGTGTAGGAGCTGGTTAGGTTAGGTGCAAATCGACATCCTC
ATTTATGTTGCACGATTTGAGGCGTTTATAACAAAATATAATACTTCATTATTTCATTATAATTATTGTCCTACATTATTTTATACAAATAAATAAAATTTAATAATTAAATAAATAATA
ATAATTTTATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGATATAAGTAAAAAAGCTAATTAATATTATACTGAAAAGTTT
AAATTATAATTATTTTGAGATAAATTTTTTATTCTTATACAAAGATTATTATGAAACGTCTATATATTGAGGGAGTAAAAAATTTGAAGCGCACACACAAAAGAATTAAACGATGCTGCC
TATTGACCACAACTTCCTACAAAATTCAGTAGAAATTTTGTATTTATAATACAATAAACGAAAAGAAATTCGCCACAACTTGACCTTATAATTAATTAATGAATAATGACATGTACATAT
GACTCATGAGAAACCCTAGTAACACACTTTTTTAGTAACACGTGTTTTTAAATATATTAGTATTTTTTTATTAAATGCTACTACAAAATTATGAGAAAAAAGCCATTAAATAAATAATAA
GACTTACAAAATTTTGTTATTTTCATCAAGTACGTGTTACATGACTGATACATTAATTTCTGTAATGTGAATACATACATATAGGTGGGCATACGATAGGTACAAGTGCTTGCCGATCTT
TCGCAGACAGAATATACAACCCCAATGGCACTGATCCTTCCATCGACCCTTCATTTCTTCCATTTCTGCGACAAATTTGCCCACAAACACAACCAACGAAGCGAGTGGCACTAGACACAG
GAAGCCAATTCAAATTCGACACGTCCTACTTCGCTCACCTAGTTAGAGGCCGTGGAATTCTCCGTTCTGATCAGGTTCTTTGGACTGATGCTTCCACAAGAGGCTTTGTTCAGAAATACT
TAGCCACAGGTCCCTTCAAGGTCCAATTCGGAAAGTCTATGATCAAGATGAGCAACATTGGTGTCAAGACCGGTTCTCAGGGTGAAATTCGCAAGATATGTTCTGCTATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGGTGGTTTGTGGAAGAAAGAGTTGGTTCTAAGGTTTGTTGTGCTTGCTGTGGCTGTTGTGAACACAGTGCAATGGAATGGAGAAGGCACGCGTGTAGGGTTCTATTCGAGCACA
TGTCCACGTGCCGAGTCCATTGTCAGGTCCACAGTGGAATCCCACCTTAGGTCAGACCCTACTTTAGCTGGTCCAATACTTAGGATGCACTTCCATGATTGCTTTGTGCGAGGTTGTGAC
GCTTCTGTTCTCATAGCCGGTGCTGGCACTGAGAGAACAGCGGGGCCAAACCTTAGTTTGAGAGGATTTGATGTCATTGACGATGCTAAGGCTAAGATCGAGGCTCTGTGCCCTGGTGTT
GTCTCTTGTGCTGATATCCTTAGCCTTGCTGCTCGTGATTCTGTAGTTCTG
AGTGGTGGACTAAGTTGGCAAGTGCCCACAGGACGCAAAGATGGAAGGGTTTCAATTGGATCAGAAGCC
TTAACTTTGCCTGGTCCTAATGATACCGTCGCAACCCAGAAGGATAAGTTTTCAAACAAGGGCCTTAACACCGAAGACCTCGTCATTCTTGCTG
GTGGGCATACGATAGGTACAAGTGCT
TGCCGATCTTTCGCAGACAGAATATACAACCCCAATGGCACTGATCCTTCCATCGACCCTTCATTTCTTCCATTTCTGCGACAAATTTGCCCACAAACACAACCAACGAAGCGAGTGGCA
CTAGACACAGGAAGCCAATTCAAATTCGACACGTCCTACTTCGCTCACCTAGTTAGAGGCCGTGGAATTCTCCGTTCTGATCAGGTTCTTTGGACTGATGCTTCCACAAGAGGCTTTGTT
CAGAAATACTTAGCCACAGGTCCCTTCAAGGTCCAATTCGGAAAGTCTATGATCAAGATGAGCAACATTGGTGTCAAGACCGGTTCTCAGGGTGAAATTCGCAAGATATGTTCTGCTATT
AATTAA

Retrieve as FASTA