Entry information : Mmul1CysPrx (PrxVI)
Entry ID 4428
Creation 2007-01-25 (Nicolas Rouhier)
Last sequence changes 2007-01-25 (Nicolas Rouhier)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2010-11-22 (Myriam Duval (Scipio))
Peroxidase information: Mmul1CysPrx (PrxVI)
Name (synonym) Mmul1CysPrx (PrxVI)
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Cercopithecidae Macaca
Organism Macaca mulatta (rhesus monkey)    [TaxId: 9544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Mmul1CysPrx
start..stop
S start..stop
Mnem1CysPrx 456 3e-166 1..224 1..224
Mfa1CysPrx 454 1e-165 1..224 1..224
Ptro1CysPrx01-2 451 3e-164 1..224 1..224
Ptro1CysPrx01 451 3e-164 1..224 1..224
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 203122798..203122892 95 N° 2 203126718..203126874 157 N° 3 203130660..203130806 147 N° 4 203131568..203131714 147
N° 5 203133072..203133200 129  
join(203122798..203122892,203126718..203126874,203130660..203130806,203131568..2 03131714,203133072..203133200)


exon

Literature and cross-references Mmul1CysPrx (PrxVI)
Protein ref. GenPept:   XP_001101473
DNA ref. GenBank:   NC_007858.1 (203122798..203133200)
Protein sequence: Mmul1CysPrx (PrxVI)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   224
PWM (Da):   %s   24910.1  
PI (pH):   %s   5.81
Sequence 265
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGGLLLGDEAPNFEANTTVGRIRFHDFLGDSWGILFSHPRDFTPVCTTELGRAAKLAPEFAKRNVKLIALSIDSVEDHLAWSKDINAYNCEEPTEKLPFPIIDDKNRDLAILLGMLDPAEKDEKGMPVTARVVFVFGPDKKLKLSILYPATTGRNFDEILRVVISLQLTAEKRVATPVDWKDGDSVMVLPTIPEEEAKKLFPKGVFTKELPSGKKYLRYTPQP

Retrieve as FASTA  
Remarks Genomic (automated prediction).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCCGGAGGTCTGCTTCTCGGGGACGAGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTCGTAAGTGGCCACCGCGTAGCCCTGCC
CTGGCCTTGGTTGCGCCTGGACTCGGAGGTGCCTTCCCTATTTCTTCTCCCTTCCGTCCTCCCTGCCGCTCAGCCCCCTGCGCCGCTCGCCCCCTCCCCCGCACCGGTTTCGGCGCGCGC
CAGGCCGTGTGGCCCCTGCTCAGCGTCGGCTGCGCCCCCGGGAGCTGGCACCCCTTCAGCCTGCCCTGCGCGAGCCACTGGATCCCTCCAGGCCTCCCCGCCTCCGGCGTGGCTGGGCAA
GGCCACGCCAAGGTGGGGGATGGGGAGGACAAAATTGGGTTCTGCAGGTTCTGGAAACTCACTGCCCGTGGGAGGGTTTGTTGTCCGTTGAACTCGTCTTAGTAAACTGCAGGTAGCGTG
GTCAGGCCGAGGGCGCAGGGGCGGGTCGGCATTGGCGATCACTTCCCCGGTCTAGTGCCCAGGGTCGCACCGCCCTCCCTCCCACCCTCCGTTCTGGAATTTGCTCCCTGGGGAGGATGG
GTGTCTGAAGCCAAAGTCGGAGGACACAGCTGCTGGCTATATGTTACAGGAAGGCCAACGTATTATCTGAGGGTGCAGGGTATTTGCAGGCTTCTGGGCACAAAATGTGAAATTTAAAAC
CACTAGCTGCCTAATCGGTGGCCGAAAGACTTTTTGTCCAGACCCTCCTTCAATGACCAAGATATGATTTGATAACAGCTTTAGGAAGAGCCAAGAACACTCTGTGTAGGTGTGCCTTCA
GAGATTCCAGAACTTGCAACGCTTTTCTGACGCCGTTCAGCTGTAGTAGCGTATTCTTGCTAGTGATGGCCGTTCCAGGCTCCAGGACACGTGTACTCCCAACTTTGAGACTCTTTTGTT
TCCCAGTGGCTTGCGCCTCACTGTCCTCTCCACTTTCTGCCTTGCTTCCAGCACATAAGCTTGCTGATGATAGCCAAATTGATGACCTGTGATCTGACTTGGCAGTTTTGCCATTATGAA
TAGGAGTAGTGAATCAGTGTTGCCTTTTTTTTTTTTTTTTTTTTTTGGCAGCTCCTGGATTAGCAAACTGGAAGTTGCTTAGTTTTCATCAGAAGCATTCCAGGCATGTCTAGTTATATT
ATGGTTCTGGAGTTCTAGTGGTCCCACTACACTGTGGGGCTCCGAGGTTTGACGACAGTTCTTCCCCAGTTTATATCCTTTTTATGTACAGTATCCAGGGAGACAAAGAGAGAGGCTTAT
GAAATTAATCAATGATTGGACAGGGCTGTGCAGAGAACCAGGGAGAGATTCTTACACATCATGTGCCTACCCGGACCCTTACAACCTCTTAGGTCCCTTTTCCAGCCACTGAATAGAGGA
AAAAGCTTTGTGAAAGATAGGACTAGGCCAGAAAAAGGTTGAAAACTTGAATATTCAAACCTTGAACGCAGAAAAATACTTGAGAAATACAGCTTATGGCCAGTCTTATACTTAGGATCT
AGGTAGTAGTATTTCTCCAGTAATCCTTGGGATTTTTAGAGTTGTGTTCCTTCCCATTTCTGCCTTCAGCCCTCACCCCCATGAAACATAAACTATTTCCAGAACTCTTAGCTTGTGTAG
ATTAAATATTAGCATAAAACATATTTAACTGTTCCAACAATTAGAAATGTTGTTGCTTTTTAAGCTAACCATACTTTTTTGGGGTTTCGTTAATGTTTATTAGCCTCTAGATCCATCTAG
ATTTGATCAAAAGTGGTACTTTATCAGCCATAGTTAGGAACACGATAAAAATATCTGCATTTATTAACTAATAGACAAGTCTGCCTAGGATCAGGCGTAGTATTCCCTACCTTACCAGGA
AGAGAAGTTTGAGCCTTTTATATGTTTATGACATGGATTTTTGCCTGATTTTTCCAAACTCTATTCTGTATATGATCCCAAGTCAGACTGTCAATTTTTGATCCAGGTATTTTTGAGGAG
AAAAAATTAAAATATCTTTCTCTACCTTACCCCTGATCATTGTAAACAACTAAAGAGGTTGGGTGCTACATTGGGTGAGTTTACTGGACCTTATCACTGTTTCTGTAAGTGGTAGAAGTA
GCTTCTTCATAGCACATCTTCACTACGCAAAATATGTGTTTTCCGGGGTCTTCTGGGGCTTAGTAAATGGGAACCATTCTCTTGAAGGAGGAAACCTTTTGTCTTTTGAAAATGGGTAAG
AAAGAAAACGGGAGAATGTCACTGAATTACTCTTAAGTGCAGCAGTAGGAAGACTTAGAGGGAAAGAAAGGCCAAGGTGAGACATTCTTGGAGTTTATCCTACTTGTAGCCACGAGGTAA
ACTGGAGTTTCACTTCTGAGGGAGGGAAGGACGTGAACTGGCTTAAAACCAGTTCCTTTCGCATGATTCAGCAAAACAGTCTCTGCCGACTGACAATGGAAAAAGAACTCCTAACTTTTC
TAATTCATCCTCCCTTTAACAATACAGGAGGAAACGCCCTGTTCCATTTCTTCTCAACTTTTGGAGACCTTCTGTTAAGTCTCATCTAACCATTAAATAGATTGTTTTCCATAGAATCTA
AGGCCTAGATTTTACTCATAGTGATATTATCTACTTCAAAAGATATACTCTATGTTCTTCCTTTTGCCCTTCATAATAAAGTGAACATAGTGCACACCTCCACAATCTTAAAAAATATAT
ATTAGCTTTCTTCCCAGTCTTGCCATAGGGCCCTCCATCCTTTTCGTAAGAAGATCTTTTTCCTTCTTGAAACCTTGGGAGTTGAGTGGAAGCTGTAAGTGGGAAGGAGGTGCCCTTGTC
TTTGCTTGTTCTCTGTACTCAGGGAAACTTCGGAAAGGTCAGCTTGGCATCTAGGCAAGATTTAGTTATCTGCTAGTTTAGGATCCCGCCTAAATCATCTGGTTTAGGATAGTTTAAATT
GATGGGGATGTGGAGAACTGAGTGTTCAATTTTCCTTTTCAGTTGAAAGAGTAGTTTCTGTTGCCAAGGAGAAGGAAATGGTACTTCAGCTTTCTTAGTGGCCGCTTGAAACGTGCTCAA
AATCTATAAAATCTTAGACAATGATGACTTAGATCTTAGTATTTACCTAGGAATTTGCTATTGTAGAAATCTACATTGTAGGCTATCAAAATTCTACCTGCTTGGTCTGAAGAAAGAAGA
AAAACTGCAAATGAAGAGATAGGTAAAACTGTTAAGGTGATACTGTTTTGTCAGAGTATAAATATTGGGTGTCCTGTTTGGCAGGTTAGATCAGTAAAGTGGTTTTACAAGATTTTGTAT
CCACTTGCTTCGAAGAAACCAAGTGTCGACTTCAATTTTTACATATAAATAGAGGATAGAAACCTATTTATTTCAGATTACATAATCTGTTTATTATTGTAGTCAGGCATTTGTTTGGAT
TGAGAGCATACTGGGACATCCATTATTGGAGCTGAATGTCATGGTCTGTGCTAGAAAAAATGTAGAAAAGGATAAGAAGAAATAATTAAGTTTTTTCAGTAAGCTACTTGGCTTGAACAG
CACAGATTTTATTAGCCAAAAAGGAGTCAGGGTGGCACCATAATTATTAAAGGAAGCAACACCTTAAAATTAGTCTTTTTAAATATGTGTCATCTTGAATTTCATATCTTTGATTAAATC
GGGCTATAAGCATAGGCTTCTCTAGAGGTAAGTAGATTGAAAAGCATTCCTCAACAGAAAAGTTTAGAAGTAAATATCGTCATAAGCATTCATTTAAAAAAGAAAGCCTGTTTTTGATTC
AGAAGTTGTGACTTTTCATTCTCTGTGATGTTGGTGATAACTCTTCATTCAACTGTGACCTTGTTTTTCTTCCTTTCAGATGGGGCATTCTCTTCTCCCACCCTCGGGACTTTACCCCAG
TGTGCACCACAGAGCTCGGCAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTCAATAGACAGTGTTGAGGACCATCTTGCCTGGAGCAAG
GTTA
GTATCAATTGGCATGAACTTTGAGCCTGAGATTATAGGTCAAGTTATAAATTATAGAGTCCTTGGTTTTTGAGGTTAAGGTACAAGTAAGCTTTAGGTTCAAAGTTCACTGATTATTTGA
AAATTTCAGTTGAACCACACAGTGATCACATTGCTAAATCCATTGGTCAGTCAATTCTCAGACCTCATCTTGGCCTGCCAGCAGCATTCAACCTAGGTGATCACTGTTTTCCTTTCTTGG
CTTCTAGGACACCACATCCTAGCTGTTCCTGCTCACTGATTCTTCATCTCCCAACTCCTAATTTATGCTGAAGTTACCCTGAACTTATTTCTTGGACCTCCTCTCTTTTCTGTCTGTACT
CTTTCCCTTGGAAATGCCTTTAAATACCATCTATGTGCTGTGGTTCTCAAATTTTCATCTCTAGGCCAGACGCTTTGAGGTTCATGTAACCACTGCCTACTTAGCATCTCTCCTGGGATG
TCCAGTCATCTCAAACCTAGCATGTCTAAGTAGGCCTCATTCTTAAATCCAGAGTTTTATTCATCTAAGCTAATGGCAACTGCATTTTTATAATTGTTCACGCCCCAAATCCAGGAGCCA
TTCTGAATTCTTCATGTTTTTTCACATCATAACATCTGATTTATCCTCAAACTTGTCAGCTCTACCTTCAAGATATGTCCTGTATCATGGATGGAAGACTGACTCCCAAGGGATCTGTGT
GACTTACCCTCACCTCTTTTGGGTCTCAACTCACAGGACATTTCATCAAAGGCTTTCTTGTCCTCATTATCTAAAATGATAACTCCTTTTCACATTCACTATCCCCTCCTCCTCAGCACT
CAAATACTCTGCATATTACCTGTTTAGTTTGTTTCTTCCTAGTAGAGTGTAAACTCAGCAGGAACAGAGACTCCTGTTTTGTGCACTGCTGGAACGATGCTCACTACTCAGTACGTCTTA
GGTGATCAGTCAGTATTTGTTGAATGAATTAACTGAAGGAAATACCTACTTTTAGCAAAAGAATTTACTTGAACAATAAATTTGGTGGTCTGAATTTACCTTGAAAACATTTTAAGGACT
TCACTACAACATGCAGTTAAGTAATAATGGTAACTACTTTTTGAGGGATGTATACTAGAAACTATGTCAAGCATGTGTAGTTGAATAAAAGATGTATTGACTTGTGAGTTAGGGATCTGT
GGCTGCATCCTATAGCAGTTAACACTAGTTAATCCTAAATATCTGAGACTAGAAGAATCATGTGTAGGAGAAAAAAGAAGGGCAGTTATCTATCTTGAAATAGAATTTTTTTCATTCCTT
ACATTTCTCAGTGAGTGGTAACTGTAGTTTTCACTATCGTTTTTCATTTTCATTTTTGCAGTTGAGAATACTTTTTTCACTTAGAAACTTGGAGGGACTTGCCCAAGACTGCCCAATGGC
AATGAGATTTGAATCTCAAATCAATGGTCTTTTTAATACAAGATGATAAAAAGTAGGATTTAGCCTAATTTAGGATAGAATAAAGCCAAATAATTTAGGATACTTTCTTTGGTGTTCATG
GGTGTAATATAGTGTCCATCATGCAAGTGGCAGAGTAGAGAATTAGTGCATAGCAATAATTAAAGTGACATATTGCCAAAGGAGGTGTTTGTAGCCCATTATAGAATAGCTTTTAAAGTA
TAGAAGCATACACAGGTTTATTTTACCCTGAGCTTCTGCCTTAGAAGTTTTCACAATTGTGATTACATTGAATAGGAAAAAAGTCTGAACTACCAGAAGGAGTGCCCAAACTTTGACATA
CACCTGATATATAATAATCTGCCTCTAGCATGAGACTATATTAATTATTATTTAGCTCTGGTGACTTAATAGGCAGCCAGTGACAACAGAAAGTTAAGATAATAAAATGAAGGAATGTTA
GAATGTGTTGTCATCCAGGAGCCTGAGGCAGGAGAATGGCTTGAACCCAAGAGGTGGAGGCTGCAGTGAGCTGAGATCGTGCCACTGCACTCCACCTGGGCGACAGAGCAAGACTCCACC
TCAAAAAAATTAATAAATAAATAATAAGAATTTGTTGTTATCCACTTCAGAGCTCATCAATGCCACATTTGTTACATCTCTGTTGAGAAATCCACAATGGTTTTGTATCTGCTATGCCAC
CAAGCTCCTGTTTTACTTTCAAGCCTACACATAATAGACCTGATTCCAATTTTAAATCATTTTTTCCATTACTTGCTAAACTCTGTCCAACTAAGTTCCTCACTCTCCCATCAATAGTTT
ATGTACAGAGTTGCCCACATGTTTCATTAATATCGTTCCTGGACAAGTGCACTAGCTCACACCTATAATCCCAGCACTTTGGGAGGCCAAGGCAGGTGGATCAGAAGGTCAGAAGTTCAA
GACCAGCCTAGCCAAGATAGTGAAACCCCGTTTCTACTAAAAATACAAAAACAAATTAGCCGGGTGCGGTGGCGGGCGCCTGTAATCCCAGCTATTCAGGAGGCTGAGGCAGAGAATTGC
TTGAACTTCGGAGGCAGAGGTTGCAGTAAGCCGAGATTGCACCACTGCACTCCAGCCTGGGTGATACAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAATTTTTTTATATATATATATAC
ACATATATGTGTATATACATATGTGTGTGTGTGTATGTGTGTGTGTAGTTCTGCTCCCTAGAATGCCTTTCTTTTCTCTGTGAAAAATCTTACCCATCCTTCAAGGGCCCAGATAGAAGT
CCTATTCTTTTCTTGAAGCCTTTTCTAACTCTTGGAGTCCTACAAATGGGAGTGTTCAGTACTTCAGCATTTACCGTCCACCTTTTAACATTAGTCTTGCATTTGCTGCTGCTTCATGCT
GGAATCATCTCTAACCAAATTAGAAGTTCCTTTGAAGGCAGGAGCCATGTCTTACTCATCTGTATTCCACATGTACTTACCATAATGCTTAGCCCACCTTAAGTGCTATATCAATGCTTA
ATCAAATAACAAAACTAATTTTTTTTTTTCTCCAAAAGCTTCCAGGGATAGAAAAAGTAGAAATAAATGGATGAATAAAGTTTTACTAGGGAAGGAGGGAGACATATCATTTTTCCTTAG
TTCAGACTTGAAATGCTTTGTTTTCTGTTTGAATTTCACCCTAGTTTAGGTTTACCTCTGCCTTTTCACCCATTTATTTTTGACTTGTCCTTCAAGTATATATTCAACTCTCCATTCTTG
TGTTTGCTTTGTTTTGTGATTTTTTGTTTGTTTGTTTTTTGTCATTTCTTACTATTTGTCTTGTAACTTAACATCTGAGTCAGGGTGCTTTTGAGGCAGGGACCAGAGCTATAAGATTTT
CTTTACATATGGTATTATTTCTAGATGTGATGGATTTAACAAACCTGTTGTATCTGATGGTTTTTACAGTATTTGGGTATCCAGAGGTGCCTTGTATTTGGATGTAACTAAATTATTGCA
ATGTTAAAGGGGTTGCTGCTGTTTTCTCATGGCAGTGGAAGCATGCTGAATTTAAGAGAACTGGGCATGAAAATGGCTTTGGTCCATGATTACAACCTAAGTACTGTACTCTGCTGTTAT
TCCTGGCAATAATTGGAATGAAAAGTGTTGATTTACTCACTTTTTAAAATTAAAATTGCTTACAGAAAATTACTGTGATTTGGTCCTCTTTCCTGTCTTGCAAGGTGATGGCTGTTAACT
GATGAAATTCAGAGCATGTGTTAAGTTTAGATTCCTCTTTCCCCTTTTACTTGTGTTTCAGGATATCAATGCTTACAACTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGA
TGATAAGAATCGGGACCTTGCCATCCTGTTGGGCATGCTGGATCCAGCAGAGAAGGATGAAAAGGGCATGCCTGTGACAGCTCGTGTG
GTAGGTCATACAAATTCATTTTGTAGTCAGCA
TAACTGATCAGGCTGTATGTCCATGTAAATGCTCGTACCAGCTAGAGGAGATAGGGGAGTATCTACAATTATGAAATAACTGTGTATTGGCAACAATATCACTGATTATCTGTAATGCTG
ATGCAAAGTGGCTGAAATTTTCAACTAAATTTTTCAACTGCTTAATTCATAGTTCATGGAAATCTACAAAAAAAAAAAAAAAAAAAAGTTGTTTATCCTAAAATGTCCTCCAGAATTGAG
AAACCTTTTCATAGCTCTCCTGACCACCCTGTCTTTAAAGTGATTGGCCATATCCTTCTTCATAAGGCAGCTCTGTTTTTAAATTTTTATTTGTTCTGTCCTCTGTCCACTAGAGAACAA
ACCCGATCCCTCATCTGAATAAATGCACAACTATTCAAGGAACAATATCAACTCCCATTAGTATTATTTTTATGATAGTCATCCCCAACGGACATAGCCTTTCCTGGATTAAATTTGCAT
ATCAGTTTTTCTTACTGGGATAGCCAGAACCAAATGGAATTCCCTTCTAAGTTTAGAAAATAACAGAGAGAAGAAAAGTATCTGTATTCCAGCCATCCACATTAGCAGTTGGTGTATCCT
TTTGGTGCTTTGTTTTTGTCTTGTTTTTATACCCTTGAAAATTATTAATGACTGCAGAGCTTTCTAAGTGGCTTTAATATCAAAACACTCAAAGAACTCTTCCTATTTATGCCTTTCTGT
GCTTTGCAGGTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCCATCCTCTACCCAGCTACCACGGGCAGGAACTTTGATGAGATTCTCAGGGTAGTCATCTCTCTCCAGCTGACG
GCAGAAAAAAGGGTTGCCACCCCAGTTGATTGGAAG
GTAAAGATGTTTTTTAAAAAAAAGCAGTTTCTGTACTTGCCTGAAGGGCCAGTCTCTAAAGGGCCAACTTCAAGGTCTGTGTTA
CCTGGATCTCTGTGTCTAGCACGCAAGTACACTGGGAGGATTTTTCCTCATGACTGAGTCCAAGATTTGCTCACAGGCCCTTTTCAAGGTTTTATAACTAACACCTTTTATGTACAACAC
AAACTCTCTGTATGGCTTTCTGACTTTTAGATAATTTGGAAAAATTATTGGTCAGAATGATTCCTTTTCCTAATAGAAGGTTTAAAAAACACACACACACTTTTATCTAACCCTTCCCTG
ATGGCACAGTATTTATCGCACAATCTTGATTTGCCATTTCTGTTAAGTCATGGATATAAAAATACTGGTGTATTAATGTCATTAAGTATTTCATTTCTCTTAAGCTTCATTCTTTTAAAC
CTGTGCTAGAATTCTCCAAAATTTGTTCATACACTAAGTCTTTAAGACATGGATAACATCACAAGAGTATCTTAACATTGCTACATTTTTAAAATAATGCTAACCTGAATACCAGGTTTT
GTTTTGGTTTTTTCTGACAGACAAATCACTTAAATTCTGTATCCACTAGTTAATTTAATATTACTGATTTATGTACTTATTGAGCGCAGATAGTAGTGAACTGGGGGGATAGCAGTGAAC
AATAGAAGGTCCTTGCCCTCATAGAACTTCCATTCCAGTGAGTGGAGACAAGCAGTAAACAAGTTTATTAAGTGGTAATAGCAGGTGCTACAGGGAAGAATCAAGCACAGATGGGGAGAA
TAACAGTACAGGGGTGGGAGAGTGACTGTCAAGGAATGCCTGTCTCTGAAGGGACTTTTGGGAAGAAAGACACAGAGAAGATGTGACCAAGGCATATGTATTTGTGAGGGACGAGCACTA
CAGGCAGAAGGAGCAGTTAGTGCAAGAAGCTGGGCCTACAAATGAGCTTGGCATGTTGGAGGAATACAAGGAAAGCTAGCATGCCTGGAGCAGAAGCCGCAAAAGGTGGGGTGAGGGACA
AGAGACGAGAGGAGGCAGGATTCCATCACACAGGGCTTGCAGGCCATGATACTCACTTAGAATTAAATGTAAAGTGTGGTGGCCGGCTGTTACTGGGTTTAAAACGGCTGTTTCTTGTTA
ATATGGGGTAACTACTTTCCCACCAAAAGTGCCAAAGATCAACTTGGAAAACAAAATCCTCAAAGAGGGGAAGAGTGAAGAACACTTGATTAGTCTCATTAGCACCTGTGGCTACTTTTC
TAAAGTTAATTCATGAAGGCCTTGAAGCTTCACTATGAGACTGAATTTCACCATTCTCAATGTCTTTCAATAGGATGGGGATAGCGTGATGGTCCTTCCAACCATCCCCGAAGAAGAAGC
CAAAAAACTTTTCCCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATATCTCCGCTACACACCCCAGCCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCCGGAGGTCTGCTTCTCGGGGACGAGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTCATGGGGCATTCTCTTCTCCCACCCTC
GGGACTTTACCCCAGTGTGCACCACAGAGCTCGGCAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTCAATAGACAGTGTTGAGGACCATCTTG
CCTGGAGCAAG
GATATCAATGCTTACAACTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGATGATAAGAATCGGGACCTTGCCATCCTGTTGGGCATGCTGGATCCAGCAG
AGAAGGATGAAAAGGGCATGCCTGTGACAGCTCGTGTG
GTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCCATCCTCTACCCAGCTACCACGGGCAGGAACTTTGATGAGATTC
TCAGGGTAGTCATCTCTCTCCAGCTGACGGCAGAAAAAAGGGTTGCCACCCCAGTTGATTGGAAG
GATGGGGATAGCGTGATGGTCCTTCCAACCATCCCCGAAGAAGAAGCCAAAAAAC
TTTTCCCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATATCTCCGCTACACACCCCAGCCTTAA

Retrieve as FASTA