Entry information : GmPrx14 (Glyma20g35680.1)
Entry ID 481
Creation 2008-09-16 (Christophe Dunand)
Last sequence changes 2008-09-16 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx14 (Glyma20g35680.1)
Name (synonym) GmPrx14 (Glyma20g35680.1)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Etiolated hypocotyls
Germinating shoots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx14
start..stop
S start..stop
PvPrx09 585 0 1..314 14..326
GmPrx65 532 0 1..314 15..328
MtPrx19 527 0 1..314 14..327
GrPrx39 525 0 1..314 11..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43903203..43903415 213 N° 2 43904412..43904600 189 N° 3 43904736..43904898 163 N° 4 43905524..43905903 380
join(43903203..43903415,43904412..43904600,43904736..43904898,43905524..43905903 )


exon

Literature and cross-references GmPrx14 (Glyma20g35680.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm20 (43903203..43905903)
Cluster/Prediction ref. UniGene:   Gma.28374
Protein sequence: GmPrx14 (Glyma20g35680.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (293)
PWM (Da):   %s   34666.13 (32300.9)  
PI (pH):   %s   5.43 (5.80) Peptide Signal:   %s   cut: 22 range:22-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANLLTVFLLIEVFAYGYSYGQYGLNTNYYLMSSCPFVEPVVKNIVNRALQDDPTLAAGLIRMHFHDCFIEGCDGSVLIDSTKDNTAEKDSPGNLSLRGFEVIDAIKEELERQCPGVVSCADILAMAARDAVFFAGGPVYDIPKGRKDGRRSKIEDTINLPFPTFNASELIKSFGQRGFSAQEMVALSGAHTLGVARCASFKNRLKQVDPTLDAQFAKTLARTCSSGDNAPQPFDATSNDFDNVYFNALLRRNGVLTSDQTLYNSPRTRNFVNAYAFNQAMFFFDFQQAMVKMGLLDVKDNSNGEVRENCRKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 15 ESTs. Cultivar="Williams 82".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTTGCTTACAGTGTTTTTGCTAATTGAGGTGTTTGCATATGGCTACAGTTACGGACAATATGGCTTAAACACGAATTACTACTTGATGAGCTCTTGTCCTTTTGTTGAACCT
GTTGTTAAGAACATTGTCAACAGAGCTTTGCAGGATGATCCCACCCTAGCAGCTGGTCTGATTAGAATGCACTTTCACGACTGCTTCATTGAG
GTTTCTTCTCTCTCTCTCTCTCACACA
CTCACTCAGTACAGAAAGTTCACTCACATATGGATGTACTAGCACACTTTGCATGTTTTAAAGGGAAAAGAGATTTTGTCATTTTTAATTGTAGTTGCATTTTTAAATAGTGTATGGTTT
CTTTTAAAAAGGGAATAAATTGCATATGAAAAGGTTGAAATCGAGTTGCTAATCCTATTGGATATAAAATTGATGTGTGTAAAAAAGGAAACAAAAATCATAAATTAAAAAACTTATATA
TGTCATGTAAAAATTAATTGAAATCAATAAATAAGTAAACGATAATTCTAGACCACTTAATAATTTCTCATAAGAAAAAATAAATAAAAAAATAACTAATATTTGATTGTATTTACAGCT
GCGGTTAATATATAGCAATACGAAAAATACTAAATATACACCCGTTTTCTCTTCCACTCCATTTTTACCTCATTTTCATCTCATTTATTTTTTTATTTGTCTCTCTATTATTATAACTAT
AAAAAAAATCTATATCTTTCTTTTACTCATACACCCAAAAAAAAAGAAGTATCATTATTCTAGCAATATAATTTGAAAAATATAGCCTCCAATCTGCCTTCTACGTCATACTCTCTTAAT
AATATTTTATTATCACAAGTTTTAGTGTAAGTCATTAAATAACAGTATAGCACTTTAGTTTCACTATAATTTTTAAATAATTCAAACGAGTCTGCAACAGAGTTTCTAAAGATATAGTGC
AAATATAATTAATCTTTGAGAACTACATACGTACACTATATTATTTCTTAGAATATATGAGTGGCCAATACGTGAAAGTGGTTACTCAACTATTTCTTGTCGCTACAATGTTCACCACTG
AAAGATGTAGTGTTGTGCATGTGTTTCAACAAAGGACAAACCGGATTAAATAGTTGCATATCCACATTATTATATAGTACTTCAGAGTATTGACACATGCATCAAAATTGCTTATTATTT
TGGTATTAGGGATGCGATGGCTCTGTTCTGATTGACTCCACTAAGGATAATACAGCAGAAAAGGATTCTCCAGGGAATTTGAGCCTGAGAGGCTTTGAAGTCATAGATGCCATCAAAGAA
GAGCTTGAAAGACAATGCCCTGGGGTGGTTTCATGCGCTGATATTCTTGCCATGGCTGCTAGAGATGCAGTTTTCTTT
GTAAGATATTCAACTTAAATAATACATTACTGTTTTCTTTGT
AACTAATTTCCCTTTTTCTCTTTTGTGGTGCAATGAAGTAGTTTATTGATGTAACGTGGCTTGAAATTGATTATGATTATGAAATATGAACAGGCTGGAGGCCCAGTGTATGACATACCT
AAAGGAAGAAAGGATGGAAGAAGATCCAAAATTGAGGATACTATCAATTTGCCATTCCCTACTTTCAATGCCTCTGAGCTCATTAAGTCGTTTGGTCAACGTGGTTTTTCTGCACAAGAG
ATGGTTGCCCTCTCTG
GTAAGCACTCGCCTATATATTTATAAGTTTTGCTATCTTTTTATGTTGAATAATTTCATTGTAAACTTATTTCAAAATCAATAAAGCTTTCAGTACCGGCTTTG
GTTAGCCTTATATATGTTTAATTCTTTTCCTATTTTATTAAATATGTATAGGTTTAATTTGATAGAATCTCGTTACATCATCTGTTAACTATGTAACCAGTTGATGGAAAAAAAGTTTAA
AGACTTTAATAATGTCACTAATTTGGGATGATAAATGAATCCTTTTAGCCAATTGAAAGTTGAATTTTAATGAATCAGCACATTTAGGATTCGGATTAAAATTTATCCGATCCATTCATT
TTGTCACCCTTTGGCCTTATCACTAATATATGGCTAAAGGTTTGTCAAAATTTCAATTGGTAACATCAAACATGCATGGTTACTAAAAACCAGCTTGTATAACTTGTAGACTTGTACGGT
TGTACCCATATCCAGGATGCATGGAAATGATAGAAACCCATGTAACAAGCACTTTACCAATTCACTAGCTAGAAAGTAGAAACATGTCATTATTTAATCACATATACAGTCTAAAAACAA
ATTAACTAATGAGATGTTGGGCACTTGGCTCACATATGCAGGGGCTCATACACTAGGAGTGGCAAGGTGTGCTTCTTTCAAGAACCGATTGAAACAAGTGGATCCAACTTTGGATGCACA
ATTTGCCAAGACACTAGCGAGAACATGCAGTTCCGGCGACAACGCACCGCAGCCATTCGATGCCACGAGCAACGATTTTGACAACGTTTACTTCAACGCTTTGTTGAGGAGAAATGGGGT
TCTTACATCAGACCAAACACTCTACAATAGCCCCAGAACCAGGAACTTTGTGAATGCTTATGCATTCAACCAAGCCATGTTCTTCTTTGATTTCCAACAAGCTATGGTCAAGATGGGCCT
GCTTGATGTCAAAGACAATTCCAACGGTGAAGTAAGAGAAAATTGCCGCAAAATAAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTTGCTTACAGTGTTTTTGCTAATTGAGGTGTTTGCATATGGCTACAGTTACGGACAATATGGCTTAAACACGAATTACTACTTGATGAGCTCTTGTCCTTTTGTTGAACCT
GTTGTTAAGAACATTGTCAACAGAGCTTTGCAGGATGATCCCACCCTAGCAGCTGGTCTGATTAGAATGCACTTTCACGACTGCTTCATTGAG
GGATGCGATGGCTCTGTTCTGATTGAC
TCCACTAAGGATAATACAGCAGAAAAGGATTCTCCAGGGAATTTGAGCCTGAGAGGCTTTGAAGTCATAGATGCCATCAAAGAAGAGCTTGAAAGACAATGCCCTGGGGTGGTTTCATGC
GCTGATATTCTTGCCATGGCTGCTAGAGATGCAGTTTTCTTT
GCTGGAGGCCCAGTGTATGACATACCTAAAGGAAGAAAGGATGGAAGAAGATCCAAAATTGAGGATACTATCAATTTG
CCATTCCCTACTTTCAATGCCTCTGAGCTCATTAAGTCGTTTGGTCAACGTGGTTTTTCTGCACAAGAGATGGTTGCCCTCTCTG
GGGCTCATACACTAGGAGTGGCAAGGTGTGCTTCT
TTCAAGAACCGATTGAAACAAGTGGATCCAACTTTGGATGCACAATTTGCCAAGACACTAGCGAGAACATGCAGTTCCGGCGACAACGCACCGCAGCCATTCGATGCCACGAGCAACGAT
TTTGACAACGTTTACTTCAACGCTTTGTTGAGGAGAAATGGGGTTCTTACATCAGACCAAACACTCTACAATAGCCCCAGAACCAGGAACTTTGTGAATGCTTATGCATTCAACCAAGCC
ATGTTCTTCTTTGATTTCCAACAAGCTATGGTCAAGATGGGCCTGCTTGATGTCAAAGACAATTCCAACGGTGAAGTAAGAGAAAATTGCCGCAAAATAAACTGA

Retrieve as FASTA