Entry information : GmPrx16 (Glyma17g06890.1)
Entry ID 484
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2005-06-21 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx16 (Glyma17g06890.1)
Name (synonym) GmPrx16 (Glyma17g06890.1)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Floral meristems
Roots
Roots hairs
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx16
start..stop
S start..stop
GmPrx233 619 0 6..324 10..324
PvPrx18 595 0 1..324 1..324
MtPrx14 563 0 1..324 1..323
GmPrx182 552 0 1..324 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4948831..4949040 210 N° 2 4949657..4949848 192 N° 3 4950018..4950183 166 N° 4 4950363..4950769 407
join(4948831..4949040,4949657..4949848,4950018..4950183,4950363..4950769)


exon

Literature and cross-references GmPrx16 (Glyma17g06890.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm17 (4948831..4950769)
Protein sequence: GmPrx16 (Glyma17g06890.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (301)
PWM (Da):   %s   35830.26 (33394.9)  
PI (pH):   %s   9.32 (9.32) Peptide Signal:   %s   cut: 24 range:24-324
Sequence 365
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
METPKFAFLSLLLLLTSATISSAQLSSGFYKNTCPNVEQLVRSAVAQKFQQTFVTAPATLRLFFHDCFVRGCDASILLANGRPEKDHPDQISLAGDGFDTVIKAKAAVDRDPKCRNKVSCADILALATRDVVNLAGGPFYNVELGRRDGRISTIASVQRHLPHPEFNLDQLNSMFNFNGLSQTDMIALSGAHTIGFSHCNKFSNRIYNFSPRNRIDPTLNLQYAFQLRQMCPLRVDPRIAINMDPVTPQKFDNQYFKNLQQGKGLFTSDQVLFTDARSKATVNLFASNEGAFQKAFVDAVTKLGRVGVKTGNQGEIRFDCTRPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 8 ESTs. Roots of 'Supernod' plants, roots of bulked plants, floral meristematic mRNA, root hairs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAAACTCCTAAATTTGCATTCTTGTCTTTGCTTCTTCTCCTTACTAGTGCTACTATAAGTTCAGCTCAACTAAGTAGTGGCTTCTACAAGAACACATGCCCCAATGTGGAGCAGTTGG
TTCGCTCTGCTGTTGCACAGAAGTTCCAACAGACCTTTGTGACTGCTCCTGCCACTCTTAGACTCTTCTTCCATGATTGCTTTGTGAGG
GTGTGTATATTCCTTCTTCATCACTTTCATG
GTTTTCTTACGTACATAACTTAGCATGGTTTGAGTTCACATATATTTCTTTATCATTATTTTGTTAATTAAAACGAAAATTTATGTGTGCTTAATTTTGCATTCAGGAACCTTCACAAAA
CTATATAGGTTCTATATACAATTATTATCTATTAGTCTATATTTTCAGCTTAAAAACATTTTTTTAGTGAAGTCAGACTATATATAATTAGTCAATATTATTAGCTCTGAGCCCATCCTA
GTGGTCATTGTTGGGTTTATTGGCCACTTGTTATCCAACCACATACAAATATCCAATCATGTAAAATTCATATCCCATGATGCTTAATTCTCAACATAAGGATTGTGTGTTGAAGATCTC
ATAATATTAGTGGCCAAAACAATATATATAAATAGAACATAATTATAATCTTATGAGCTAGTTTTTTAGTTAAACTCAAAGTATAAGAACTCTAATGAAATTTTAGCATGTTTATCATTT
AGACTATAGAGTAAACAGTAGGTTTTTAAAATGACTGATGACTTTTTTTATTTTATTGTTGATTATTTTGTATGTAAGGTGATAACAAATTTGTTTGCGCAACAGGGTTGTGATGCTTCG
ATTTTGCTTGCAAATGGTAGGCCAGAGAAGGATCATCCTGATCAAATTTCTCTAGCTGGTGATGGTTTTGACACAGTGATTAAAGCCAAGGCAGCTGTTGATAGAGACCCTAAGTGCCGT
AACAAAGTCTCTTGTGCTGACATACTCGCTCTGGCTACTAGGGATGTCGTAAATTTG
GTATTATTTCATTTTCTTTGAAATTTTATTTGCTTCGTTAAGTTATTGACCATAATGACCAGC
AATTCATTAGTTTACCTCTAAATCGTTTGATCGATGCCCATTAAGAATTATACTGTTTGACGACATTGCATTCCCAATAGTAATAATAAGTGCATATCATTAATAGGCTGGTGGACCATT
TTATAATGTTGAATTGGGAAGGCGTGACGGGAGAATATCTACTATTGCCAGTGTTCAACGCCATCTTCCTCACCCTGAATTCAATTTGGATCAGCTCAATTCCATGTTTAACTTTAATGG
CCTATCCCAGACAGATATGATTGCATTATCAG
GTAATTTCACCAGCAAAAAAAAAAAAAAAAGAGGTTCTATTTTATTCAATCATACTTACTTTTATAACTTTAAACCAAACATGTATTA
AATTATAGTAGGATAAAGAATGTTAGGTAGTTTAATTTAACTTTTTTATATAACAAAGCCTGAAGAAGAATAATGTGTTTTAATATGCTAGGTGCGCATACAATTGGGTTCTCTCACTGC
AACAAATTCTCGAATCGAATCTACAACTTCAGCCCCAGAAACAGAATTGACCCAACACTGAATTTACAATATGCTTTTCAACTTAGGCAAATGTGCCCCTTAAGGGTTGATCCTAGAATA
GCCATAAACATGGACCCTGTCACGCCTCAAAAGTTTGACAACCAATACTTCAAGAATCTGCAGCAAGGTAAGGGTCTCTTCACTTCTGATCAGGTGCTGTTTACAGATGCAAGGTCAAAG
GCCACAGTCAACTTATTTGCATCAAATGAAGGAGCTTTTCAGAAAGCTTTTGTTGATGCTGTTACTAAGTTGGGAAGGGTTGGTGTTAAAACTGGAAATCAAGGTGAAATTAGGTTTGAT
TGCACCAGGCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAAACTCCTAAATTTGCATTCTTGTCTTTGCTTCTTCTCCTTACTAGTGCTACTATAAGTTCAGCTCAACTAAGTAGTGGCTTCTACAAGAACACATGCCCCAATGTGGAGCAGTTGG
TTCGCTCTGCTGTTGCACAGAAGTTCCAACAGACCTTTGTGACTGCTCCTGCCACTCTTAGACTCTTCTTCCATGATTGCTTTGTGAGG
GGTTGTGATGCTTCGATTTTGCTTGCAAATG
GTAGGCCAGAGAAGGATCATCCTGATCAAATTTCTCTAGCTGGTGATGGTTTTGACACAGTGATTAAAGCCAAGGCAGCTGTTGATAGAGACCCTAAGTGCCGTAACAAAGTCTCTTGTG
CTGACATACTCGCTCTGGCTACTAGGGATGTCGTAAATTTG
GCTGGTGGACCATTTTATAATGTTGAATTGGGAAGGCGTGACGGGAGAATATCTACTATTGCCAGTGTTCAACGCCATC
TTCCTCACCCTGAATTCAATTTGGATCAGCTCAATTCCATGTTTAACTTTAATGGCCTATCCCAGACAGATATGATTGCATTATCAG
GTGCGCATACAATTGGGTTCTCTCACTGCAACA
AATTCTCGAATCGAATCTACAACTTCAGCCCCAGAAACAGAATTGACCCAACACTGAATTTACAATATGCTTTTCAACTTAGGCAAATGTGCCCCTTAAGGGTTGATCCTAGAATAGCCA
TAAACATGGACCCTGTCACGCCTCAAAAGTTTGACAACCAATACTTCAAGAATCTGCAGCAAGGTAAGGGTCTCTTCACTTCTGATCAGGTGCTGTTTACAGATGCAAGGTCAAAGGCCA
CAGTCAACTTATTTGCATCAAATGAAGGAGCTTTTCAGAAAGCTTTTGTTGATGCTGTTACTAAGTTGGGAAGGGTTGGTGTTAAAACTGGAAATCAAGGTGAAATTAGGTTTGATTGCA
CCAGGCCCAACTAG

Retrieve as FASTA