Entry information : GmPrx17 (Glyma02g15280.1)
Entry ID 485
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-10-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx17 (Glyma02g15280.1)
Name (synonym) GmPrx17 (Glyma02g15280.1)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Germinating shoots
Leaves
Roots
Inducers Cyst nematode infection
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx17
start..stop
S start..stop
GmPrx163 643 0 1..338 1..338
GmPrx60 501 2e-180 12..338 1..332
PpePrx08 467 6e-167 1..337 1..332
RcPrx31 446 9e-159 1..338 1..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13788165..13788410 246 N° 2 13786918..13787109 192 N° 3 13786624..13786789 166 N° 4 13785775..13786187 413
complement(join(13785775..13786187,13786624..13786789,13786918..13787109,1378816 5..13788410))


exon

Literature and cross-references GmPrx17 (Glyma02g15280.1)
Literature Public Soybean EST Project. Wang,G. et al. Transcriptionally regulated genes of early response to soybean cyst nematode's infection in resistant soybean PI 437654.
DNA ref. Phytozome 12:   Gm02 (13788410..13785775)
Protein sequence: GmPrx17 (Glyma02g15280.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338
PWM (Da):   %s   37856.71 Transmb domain:   %s   i5-27o
PI (pH):   %s   6.04
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTCKLVIYFTFFFCLLFTLVPYVHMYPSYPYSGNYQLDLNFYDRSCPNLQRIVGYGVWLALKNDNRMAASLLRLHFHDCIVNGCDASVLLDDTPYFTGEKNALPNRNSLRGFEVIDDIKEHLERICPSTVSCADILALAAREAIDQIGGPSWQVQLGRRDATTTSKEAAEQQIPSPIEPLENITAKFFSKGLDMKDVVALSGAHTIGFARCFTFKGRLFDFQGSGRPDPALDFSLLSKLQNTCPNEDASNSNLAPLDATSTMMFDNEYYRNIVYNTALLESDQALLKDRRTAPTVYYYSNNRFSFYNDFAKSMVKLSNVGVLTGAEGQIRYKCGSVNY

Retrieve as FASTA  
Remarks Complete sequence from genomic and 14 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTGTAAACTTGTGATCTACTTCACTTTCTTCTTCTGCTTGCTTTTTACCTTGGTTCCTTATGTTCATATGTATCCCTCGTACCCCTATAGTGGAAATTACCAGCTTGACCTCAAT
TTCTATGATAGATCATGCCCAAATTTGCAAAGGATTGTTGGATATGGTGTTTGGTTAGCCTTAAAAAATGACAACAGAATGGCCGCGTCCCTCCTTCGGTTGCACTTTCACGATTGCATA
GTAAAT
GTAAATTTTGTTCTGCTTTAATTAGGATTTTCTTATTTCTTACACTTCAAAATGAACAACACACGTACTTAATTTGCATGGCTTTATATGTCTTTCCGTCAGACTCTAAATCAT
ACTAGATCACACTAATTAGTAGTTGTTGGAGGAATTTTCATAAATATAAATGATAGTTTTGATGATAGAAGCATGTTGTTAATTGATTGACTCTAGAAATATATTAGTTGAATAAATACT
TGAACGTGTTATAATTGGTCCTTATCCACAAAAATTTATTCCCACTACTTGGGCACTTTGGCCCCTTGCTACCTTCCCGTTCCTATATCTATATTTGTTTTATGAACATTAGGTAGACAC
AACACATTAAATCTAGAAACTTAGTTTTCCTTATTAACTCAATTAATAAGAACGGATCACATACACGTGCATAGATATAGATTTGAAATGGGTTAGATCAGACTACTTAAGATTATTTTT
TTTATACCGGGGAGGGGCAGAGCCCCTAGATTTATTTCTAACTTCTAACACATTTGGAATTTTATTGTGGTGGAAATCTTTGTGTGACTGGACATACAGGAGAAAAAGAAAAAGTGAAAC
GTGATAATAAAATGTGGTAGGAAAGAAAAATGGAGTGAAAAAAAAAAGTTGTATGATAATAATAACTCATTTTTTTTTACACAATAATAACAGTTTTACCCTCATTCAATCACAATTTAT
CATTAATATGAGTTTTAAGATAATTATTATAAAAATTAATAAATTTATCATTTATTATAGTTTGTGATTGATCAAACAACAATGTATGTTAGTGCATAATGTTCTCATATAATTAAACTT
AATCCGTTTCCCTTTCCACCGTCTCTCATAAGCTTTAGTTATACTTTAGTGCATAATTTTGAAGGTTATATGTATTGTATATTATCACATTTGTAATTAACCCTCTTTTTTATTTTTGTT
TACATTACATAAGTAATTATCACATTTAGTATATGCTACTAAAATCATAATAACTTATACGGGGAAGTCATTAATTATTTTCAATTGCTTGTCAAATTAAGGGCTGTGATGCTTCTGTAC
TTCTTGATGATACACCATATTTTACGGGCGAAAAGAATGCTCTTCCTAATCGCAATTCACTTCGGGGGTTTGAAGTCATTGATGACATAAAAGAACATCTTGAAAGGATATGTCCATCAA
CAGTTTCCTGCGCTGATATATTAGCCTTAGCAGCTAGGGAAGCTATTGATCAG
GTAAAAGTGACACTTCCTTTAAAGTATTGGACACATATTGTCTCAACTGAAAGTTCCTTTATTAATC
AACCTATTTGATTTAACTAACGTTGTTGTTGAATCTTCCCCTATGTTTTGGGGTGTTTTAGATTGGAGGGCCTTCTTGGCAAGTTCAATTAGGCCGAAGAGATGCAACAACAACAAGTAA
GGAAGCAGCTGAGCAACAAATTCCCTCACCAATTGAGCCTCTAGAAAACATTACTGCAAAGTTTTTCTCCAAGGGTCTTGACATGAAGGATGTCGTAGCCCTTTCAG
GTTTTTACTCTTT
TCTCACCTTTCTCTAACTTCATTTAGAATACACAAATACTAACTAGCATCTTAAATAAAAAAATTTCAATAAAAATTGGTATTAATATACATGTATTGTGATTTCCAATGCATTTCAAAT
GTGAACTTCGTAATAGGATACTGGTTAAGAAGACTATTTAGAATATATATCATTCTAATTTTATGAAGTAATAGAAACTAACTTCAACTTTCACTAAATATCTTAAGCTCTTTTTAGTAT
ATGACTATGATGACATCATATATTGTTAAATGATCAAATCTGATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCAATTC
ACTGCTAGATCAACTTTATATCTCAATTTGACATGAATAACTTTATGTGTCTATTTTCATCAGGAGCACATACAATTGGTTTTGCCCGATGCTTCACCTTCAAAGGGAGACTTTTCGACT
TTCAAGGGTCTGGCAGACCTGATCCCGCGCTTGACTTCTCACTTCTCTCAAAATTGCAAAACACTTGTCCAAATGAAGATGCTTCAAACAGCAATCTAGCACCTCTTGATGCTACAAGTA
CTATGATGTTTGACAATGAGTATTATAGAAATATCGTATACAACACAGCGCTTCTAGAATCTGACCAAGCACTACTTAAGGATCGAAGGACTGCTCCTACGGTTTATTATTACAGCAACA
ACCGGTTTTCCTTCTACAATGATTTTGCCAAATCCATGGTGAAGCTTAGTAATGTAGGAGTACTTACAGGAGCAGAAGGGCAAATTAGATATAAATGTGGCTCTGTAAACTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTGTAAACTTGTGATCTACTTCACTTTCTTCTTCTGCTTGCTTTTTACCTTGGTTCCTTATGTTCATATGTATCCCTCGTACCCCTATAGTGGAAATTACCAGCTTGACCTCAAT
TTCTATGATAGATCATGCCCAAATTTGCAAAGGATTGTTGGATATGGTGTTTGGTTAGCCTTAAAAAATGACAACAGAATGGCCGCGTCCCTCCTTCGGTTGCACTTTCACGATTGCATA
GTAAAT
GGCTGTGATGCTTCTGTACTTCTTGATGATACACCATATTTTACGGGCGAAAAGAATGCTCTTCCTAATCGCAATTCACTTCGGGGGTTTGAAGTCATTGATGACATAAAAGAA
CATCTTGAAAGGATATGTCCATCAACAGTTTCCTGCGCTGATATATTAGCCTTAGCAGCTAGGGAAGCTATTGATCAG
ATTGGAGGGCCTTCTTGGCAAGTTCAATTAGGCCGAAGAGAT
GCAACAACAACAAGTAAGGAAGCAGCTGAGCAACAAATTCCCTCACCAATTGAGCCTCTAGAAAACATTACTGCAAAGTTTTTCTCCAAGGGTCTTGACATGAAGGATGTCGTAGCCCTT
TCAG
GAGCACATACAATTGGTTTTGCCCGATGCTTCACCTTCAAAGGGAGACTTTTCGACTTTCAAGGGTCTGGCAGACCTGATCCCGCGCTTGACTTCTCACTTCTCTCAAAATTGCAA
AACACTTGTCCAAATGAAGATGCTTCAAACAGCAATCTAGCACCTCTTGATGCTACAAGTACTATGATGTTTGACAATGAGTATTATAGAAATATCGTATACAACACAGCGCTTCTAGAA
TCTGACCAAGCACTACTTAAGGATCGAAGGACTGCTCCTACGGTTTATTATTACAGCAACAACCGGTTTTCCTTCTACAATGATTTTGCCAAATCCATGGTGAAGCTTAGTAATGTAGGA
GTACTTACAGGAGCAGAAGGGCAAATTAGATATAAATGTGGCTCTGTAAACTATTGA

Retrieve as FASTA