Entry information : GmPrx19 (Glyma15g13560.1)
Entry ID 488
Creation 2007-02-02 (Christophe Dunand)
Last sequence changes 2007-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx19 (Glyma15g13560.1)
Name (synonym) GmPrx19 (Glyma15g13560.1)
Class Class III peroxidase    [Orthogroup: Prx043]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Germinating shoots
Hypocotyls
Immature pods
Leaves
Roots
Inducers Auxin treatment
Cyst nematode infection
Pathogen interaction
Phytophthora infection
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx19
start..stop
S start..stop
PvPrx08 612 0 13..358 7..355
GmPrx260 540 0 30..358 21..349
GmPrx69 540 0 30..358 20..347
MsPrx15 533 0 18..357 11..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10154141..10154377 237 N° 2 10154659..10154850 192 N° 3 10157193..10157358 166 N° 4 10157643..10158124 482
join(10154141..10154377,10154659..10154850,10157193..10157358,10157643..10158124 )


exon

Literature and cross-references GmPrx19 (Glyma15g13560.1)
Literature Tyler,B. Not Published. Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm15 (10154141..10158124)
Protein sequence: GmPrx19 (Glyma15g13560.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (326)
PWM (Da):   %s   38953.66 (35270.7) Transmb domain:   %s   i12-29o
PI (pH):   %s   7.69 (6.70) Peptide Signal:   %s   cut: 33 range:33-358
Sequence 399
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLMIQNRKKMRFFTVKVALCCVVVMLLTLSDAQLDNSFYKDTCPRVHSIVREVVRNVSKSDPRILASLIRLHFHDCFVQGCDASILLNDTATIVSEQSAPPNNNSIRGLDVVNQIKTAVENACPGIVSCADILALAAEISSVLAHGPDWKVPLGRRDSLNSSFSLALQNLPGFNFTLDQLKSTFDRQGLNTTDLVALSGAHTIGRSQCRFFAHRIYNFSGNGNSDPTLNTTLSQALRAICPNGGPGTNLTNLDLTTPDRFDSNYYSNLQLQNGLLRSDQVLFSTSGAETIAIVNSFGSNQTLFYEHFKVSMIKMSIIEVLTGSQGEIRKHCNFVNGDSSNLATLATKKSSEDGMVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic and 22 EST. Germinating shoot from 3 day old seedling.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTTGATGATTCAAAACAGAAAAAAAATGAGGTTTTTTACAGTGAAAGTAGCTCTGTGCTGTGTGGTGGTTATGCTACTAACCCTCTCAGATGCACAGCTAGATAACTCTTTTTACAAGG
ACACGTGTCCAAGAGTGCATTCTATTGTGCGTGAAGTTGTCAGAAATGTTTCCAAATCTGATCCCCGCATTCTTGCCAGTCTCATAAGGCTCCACTTTCATGATTGTTTCGTTCAA
GTAT
GTAGTATTAGTTCTTAATTGCTATTACTTGTCTTAATCTAAGTTTATACTCCTTAACACAACTCAATAGCCAAACACTAGAATGTTTGTTATTTTTGCTGTCACCGTCCTCTTACCTGTA
CTTTTTCATTTACGATATCTAGAGAACTTATCTGAAAAAATCAAACTCAATTTCAGTTGAACTAAGGACTTGTTGCTAGATTGAAATGTTATTACTTATCAAGTTTTATGCTTTTAGATA
ATTGAAATTAATGTTACTATACATATGTACATGACAGGGGTGTGATGCATCAATTCTGTTGAACGACACAGCTACGATCGTGAGCGAGCAAAGTGCACCACCAAATAACAACTCAATAAG
AGGTTTGGATGTTGTGAACCAGATCAAAACCGCGGTGGAAAATGCTTGCCCAGGCATAGTTTCTTGCGCTGATATCCTTGCTCTTGCAGCTGAGATATCTTCTGTTCTG
GTATGTATATG
CCATGTCTCATATTCCTATATTCAGTGTATTAATTAATTTCTTGTCGAGTGTTAATGGATATCCACCTAAAACCTAATCAAGCTGATATATATAGGTAAAATAGTGTATAAGTGGATATA
ACTTTTTGAGACTTAAACAATTCTAAATTATCCAAGTAGGATCACTTATTATAGTGATTGGGTCATCGTCAAACTATAAATAAATGTTTTGTCTCGCAAATTTTACATTCTCTCAGGAGA
TATACTGAAAGATCTGATATTTGTTAATGATATAACTAAAATAATACTCCCTTTAGACCAAAGCAATTGTTGTTTAAAATTAATGCACACAATTTTAAAAAAATATTACTCACAAACTAT
ATATTTAATCTAAAATACTTCATTTAACATCACGAGAATAATATCATCGAATAGATTATAATTATTTAAATCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAA
ATAATTAATGAGACTTAGCATATGTAAAACATCAATCATTTTGAAATAAAAAATAAATAAACAATTAAAATATCTATAGTTTTGAAATATAGGGAGCAGCCTTCACCTCATTAACTAATT
TTGGTTGAGGTAGGTAAGAAGAACTATAATTGTAAAAGTGTTGAACTGATTAATGTTAGCTATCTCCCGACGGTAAGTGTGGTTGTGTACTTATTGTAAAAAATTTAATGATTCCGCACA
ATAATGAATTTTAGTCACGCCAAATACTTGCACACATGCAATAAAATAAATATCTTTTCATAGACAAAAAATATGCCTCTTGCATCGATATGAACAGAAAAAACTTTTACCCCTGTTCAA
GTCCCATCGCAAAGGATTACCCAGTTCCAGGTAGGTGTTGGTGACCATGCATGGTAGCAGGAAGGAAGCTTCCGGGTACTTATAATGGTACTAAAAGCTCACACGTCAATAATCAATTAT
TATACCAAAAATAAAGTAAGTCCATGACATGAAGGACCTTTTTTAACAAATTGGCAGGCCTTCCTTTAAATGTACTAGCAATCATATCTCATACAGTATATTACACGAATATTCATAACT
ATGTCTAAAATATATATTTTAAGGGAAAATATTAAAAATAATTATTTAAAAATAAATTAAAATATAAATATAAGTATTGCAATTTTTAATTTTGAAAGTAAGGGAAATCAATTTAATTAT
AGATTATATTTGTTTTGAATTTTAAAAAATGACTATATAATATAATTGTTTTAGAGTTTTTTTCATAAACTATTATATTTAAGAGTAATGATACACGTATACCATTTATTTTAAATATAT
TGCCCACATCTTTCATTTTTTTTATATCTCTCTTCATGTCATAAATTTTATTTTATTTATATTTTTTTTTCAATTTTCTCTTTTTCTAGATGGTGTTCATCAAACATTTTTTAATATTTA
ACTTGTAAAAAAAGTACCAAAAACATTTGTTAGGTTTTTTCTTTTTCTAAAAAAATTACATAATAATTGTATTTTAAAAAAAATAACTGAAGGAAATAAACGCATCCAGATCTTAAATAT
CTCATTGTATTTAATATTATTTAAAAAAATTGAATATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTATCTCACTCCAAAAAATAAGTATTAAAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCTTT
TTTACCGACTCAATGGTGGTGGGATTTGGTCAAAACAAACCTACTTAATATGTTGGGAAGGAGAATCCAACGAAACATGTCCCATGCGATGGCGATAAGATACTCACTTACCCAGATAAT
ATCATTTTGATTTGGGCTGAGGTATTAACTGGCCTTTGAGTGATAGGATTGTTTACCCTAAAGCCCAAGTCTAAAGCCCAATCGGGAAGACTTTTTCAGTTTTCAATATATTTTTCCATT
TTGAGGAGAAAAATCTTCTTAAGCTCTTTAGTAATAAATAAATAAACAAGTTTAGGAATATCTGTGTTTTGTTTTAATTCTATTGGACTATTTTAAAATTTTGAAGATTTCTTAAATTAG
TGTTAAGTAAATAATCTCGCACATTTATTAATATAGTTTTATAAATTAAGTCAACATTGAATGAATAATAGGTCATTTATAAAATATTGTTTTTTAGAATCACTTGTCATATATTTTTGT
GTGTTGAAAACCTTTCTTTCTTATTTTGTTTGTCTTATTATTACTTATTAGGCTCATGGCCCTGACTGGAAAGTTCCACTAGGAAGAAGAGATAGTTTAAATTCAAGTTTTTCTCTTGCT
CTTCAAAATCTTCCGGGTTTCAATTTCACCCTTGATCAACTCAAATCTACATTTGATAGACAAGGCCTCAATACGACTGATCTAGTTGCTTTGTCAG
GTATGAAAATTTTACATTTCAAG
AAATATCCTTAATAGAATTGATGTTGGTGTACAAGATAAAGTAACTAAAATACAAGTTTTAGGCTCGCCCAAAAAAATATTTCTTTTTAGTTTTTATAAAACAAAAAGATCATATTTGTT
AAAGAAAATATCACATATGTTAAAAAAAATCTAATATTTATTTTTTTCATTTAAAATAAGATATTTCTTTTAAAATTTACTTTAGATCTCACATGCCATCTAGCATTGTCGATGTATCAC
ACATATATGTTTCAATTTCAGGTGCTCATACAATTGGTAGATCTCAATGTAGATTTTTTGCTCACCGAATATACAATTTCAGTGGCAATGGCAACAGTGACCCAACTCTCAACACTACCC
TCTCACAAGCACTACGAGCAATATGTCCCAATGGTGGACCTGGAACCAATCTCACCAATTTGGACTTAACTACTCCTGATAGATTTGACTCCAACTACTACTCAAATCTTCAACTTCAAA
ATGGCTTGCTTCGGAGTGATCAAGTGTTATTTTCTACAAGTGGTGCAGAGACCATTGCCATTGTCAATAGTTTCGGTAGTAATCAAACTCTTTTCTATGAACATTTTAAGGTGTCAATGA
TAAAAATGAGCATCATTGAAGTGCTAACGGGGTCACAAGGAGAAATTCGAAAACATTGTAACTTTGTCAATGGGGATTCTTCTAATCTGGCTACTCTAGCCACCAAAAAATCTTCAGAGG
ATGGTATGGTGAGCTCAATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTTGATGATTCAAAACAGAAAAAAAATGAGGTTTTTTACAGTGAAAGTAGCTCTGTGCTGTGTGGTGGTTATGCTACTAACCCTCTCAGATGCACAGCTAGATAACTCTTTTTACAAGG
ACACGTGTCCAAGAGTGCATTCTATTGTGCGTGAAGTTGTCAGAAATGTTTCCAAATCTGATCCCCGCATTCTTGCCAGTCTCATAAGGCTCCACTTTCATGATTGTTTCGTTCAA
GGGT
GTGATGCATCAATTCTGTTGAACGACACAGCTACGATCGTGAGCGAGCAAAGTGCACCACCAAATAACAACTCAATAAGAGGTTTGGATGTTGTGAACCAGATCAAAACCGCGGTGGAAA
ATGCTTGCCCAGGCATAGTTTCTTGCGCTGATATCCTTGCTCTTGCAGCTGAGATATCTTCTGTTCTG
GCTCATGGCCCTGACTGGAAAGTTCCACTAGGAAGAAGAGATAGTTTAAATT
CAAGTTTTTCTCTTGCTCTTCAAAATCTTCCGGGTTTCAATTTCACCCTTGATCAACTCAAATCTACATTTGATAGACAAGGCCTCAATACGACTGATCTAGTTGCTTTGTCAG
GTGCTC
ATACAATTGGTAGATCTCAATGTAGATTTTTTGCTCACCGAATATACAATTTCAGTGGCAATGGCAACAGTGACCCAACTCTCAACACTACCCTCTCACAAGCACTACGAGCAATATGTC
CCAATGGTGGACCTGGAACCAATCTCACCAATTTGGACTTAACTACTCCTGATAGATTTGACTCCAACTACTACTCAAATCTTCAACTTCAAAATGGCTTGCTTCGGAGTGATCAAGTGT
TATTTTCTACAAGTGGTGCAGAGACCATTGCCATTGTCAATAGTTTCGGTAGTAATCAAACTCTTTTCTATGAACATTTTAAGGTGTCAATGATAAAAATGAGCATCATTGAAGTGCTAA
CGGGGTCACAAGGAGAAATTCGAAAACATTGTAACTTTGTCAATGGGGATTCTTCTAATCTGGCTACTCTAGCCACCAAAAAATCTTCAGAGGATGGTATGGTGAGCTCAATCTAG

Retrieve as FASTA