Entry information : PtKat02 (POPTR_0005s27300 / Potri.005G251600)
Entry ID 5156
Creation 2007-04-08 (Christophe Dunand)
Last sequence changes 2010-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtKat02 (POPTR_0005s27300 / Potri.005G251600)
Name (synonym) PtKat02 (POPTR_0005s27300 / Potri.005G251600)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtKat02
start..stop
S start..stop
PdelKat01 982 0 1..492 1..492
PtKat01 981 0 1..492 1..492
PpeKat01 979 0 1..492 1..492
GhKat01 979 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25007865..25007879 15 N° 2 25007998..25008094 97 N° 3 25008617..25008894 278 N° 4 25009198..25009974 777
N° 5 25010156..25010245 90 N° 6 25010479..25010546 68 N° 7 25010643..25010736 94 N° 8 25010835..25010894 60
join(25007865..25007879,25007998..25008094,25008617..25008894,25009198..25009974 ,25010156..25010245,25010479..25010546,25010643..25010736,25010835..25010894)


exon

Literature and cross-references PtKat02 (POPTR_0005s27300 / Potri.005G251600)
Literature JGI.
DNA ref. Phytozome 12:   scaffold_5 (25007865..25010894)
Omic ref. ePlant:   Potri.005G251600
Protein sequence: PtKat02 (POPTR_0005s27300 / Potri.005G251600)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56621.19  
PI (pH):   %s   7.29
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSAFNSPYWTTNSGASVWNNNSSLTVGSRGPILLEDYHLVEKIANFDRERIPERVVHARGASAKGFFEVTHDISNLSCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFVRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLFDDLGVPQDYRHMEGAGVNTYTLINKAGKANYVKFHWKPTCGVKCLLEDEAIKVGGANHSHATQDLYDSIAAGNYPEWKLFIQTIDPDHEDRFDFDPLDVTKIWPEDILPLQPVGRLVLNKNIDNFFAENEQLAFCPAIVVPGIYYSDDKLLQTRIFSYADTQRHRLGPNYLQLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRHDPSRHAERFPIPSAVCSGRREKCIIEKENNFKQPGERYRSWAPDRQERFVRRWVDALSEPRVTHEVRSIWISYWSADKSLGQKLASHLNVRPSV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 7 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTAATGATTCTTTATTCATCTTTTTCCTTGATTGAAAATATATATTTTTTTGCGTAAAATTAAATAAGTTTGTAGTGTAACACTGATTTGATGGTGGTGGTGATG
GTGGTGATGGCAGCACCGTCCATCAAGCGCTTTCAATTCTCCATACTGGACTACAAATTCTGGTGCTTCGGTCTGGAACAACAACTCTTCTTTGACCGTTGGATCTAGAGGTATTTTTAT
TCAAAACATATGATATCTGTTGCTGTTACCTTTCGGAGCTTAACATGATTAATTGCTATTGTTAAGGTATATGTTTGTCTGGTTTTTTATTTTGATATGTTATTATTCGATGTTTCCTAT
GTGTGGTCTAAGCTTTAAACGTTGAGGATGAAGGAATTAAGCAGCATAGTTAGAAAGTTATGATTAATTACGATTTATGTAAGAAAGAGGTAAGGAATTGTTGTACTGTTGTGGAGATAA
TTGTGCTGCTAGCAAATTTAATGGCAGAATATGAACTTTGTAATCAGATGCAAAGGATTTGGGTTGGGTTCATTTTCGATCGGAGGTTGGATGATGTGGTTCAAGCTTATTTAATAGAAA
GCAGGCTGAATCATGAACCGGGGCACACCTTATGGGGAAGGGCATATATACTTGTTAGCTTAGCCCAGATCAAGTACTGGCTTTGTTGTATTTTTGATTGTCATATATTAGTACACATAG
GTTTGATCTGCATATAACCTTTTCTTTGACAGGTCCAATCCTGCTTGAGGATTACCATCTGGTGGAGAAGATTGCCAATTTTGACAGGGAGAGGATTCCAGAGCGTGTTGTCCATGCTAG
GGGAGCCAGTGCAAAGGGTTTCTTTGAGGTTACCCACGATATCTCTAACCTCTCATGTGCTGATTTTCTTCGGGCCCCAGGAGTTCAGACGCCTGTAATTGTCCGCTTCTCCACAGTTAT
CCATGAACGTGGCAGCCCTGAAACCCTGAGGGATCCTCGTGGTTTTGCAGTGAAGTTTTACACCAGAGAG
GTGAGGTCTTATTTGATATTTCTGTTACTTTAATATAGTGGAGGAAAGCA
TATGAGTGAGGCACTGATGATGATGTAGACAATCATTTGTGTAGACTGATTCGGCAGATGTATCATATCCTCAGGGATCGATGGATTCAAATTCACTATGCATAACCTTTTGCGTTGTAA
ACTTCATTTCGATGCGTTATTCTTTTATGAAAAAATAAATTAATTCTAGTTAACTGGATGAAGCTGATTGCTTTAACTTTCCAAGGTTCCAGTTCTCTTATTCTCTATGCCTTTCCTTTT
CTTGTTGACTCAGGGCAACTTTGATCTTGTGGGAAACAATTTCCCTGTCTTCTTCGTCCGTGATGGAATGAAATTCCCAGACATGGTACATGCCCTTAAGCCCAACCCCAAGTCTCACAT
TCAGGAGAACTGGAGGATTCTCGACTTCTTCTCCCACCATCCTGAAAGTTTGCACATGTTCTCCTTTCTCTTTGATGATTTGGGTGTTCCACAAGATTATAGACACATGGAAGGCGCTGG
TGTCAACACCTACACGCTGATCAACAAGGCTGGAAAGGCAAACTATGTGAAATTTCATTGGAAACCTACTTGTGGTGTGAAATGTTTGTTAGAGGACGAGGCAATTAAAGTTGGAGGTGC
AAATCACAGTCATGCCACTCAAGATCTATACGACTCAATTGCAGCTGGCAACTATCCTGAGTGGAAACTTTTCATCCAGACAATCGATCCCGACCATGAAGACAGGTTTGATTTTGACCC
ACTTGATGTAACAAAGATCTGGCCCGAGGATATCCTGCCCCTGCAGCCAGTTGGTCGCTTGGTCTTGAATAAGAATATCGATAACTTCTTTGCTGAAAATGAGCAGCTTGCTTTCTGCCC
TGCTATTGTGGTTCCTGGTATTTACTATTCAGATGACAAGCTTCTCCAGACTCGAATCTTCTCCTATGCTGATACCCAGAGGCACCGTCTTGGACCAAACTATCTGCAACTCCCAGTTAA
TGCTCCCAAGTGTGCTCATCACAACAATCATCATGAAGGTTTCATGAATTTCATGCACAGGGATGAGGAG
GTATCTCCCCTTTTATCCCCCCTCTCTTTTGGGCACACTACTTTAATTAG
AAGCCGCGCTGTCTCACCTTCTGTTTAATTGGATCATTCTCCCCTGCTTCGCCTGTTTGAGGTTATTTTTATGTGTTTTTGCTTTTGCTTTTAGTTTGTGTTCTGATGAGTTATCATCAT
ATACTCTTCAGGTCAACTATTTCCCATCAAGGCATGATCCATCTCGTCACGCTGAGAGATTCCCCATTCCTTCTGCTGTCTGCAGTGGAAGGCGTGAGAAGGTCAGTTTCTTTCTTTCTT
TCTTTATTCTTATCGGATCTACCGTCATAAAACGAAACTGTCTTTTGCTTGAATCTCGTGTTTCTGTGTGTGAGTGTTTGGGGTCCGGTTACGATGTCTAGAGCAAGAACAGGACTAGCG
AGATTGGAAAGCTATTGTATGATTATAGAGCTCCTAGTTAAATGGACGGTCTGTTAACATATATACACACACGCACCTCTGGTGGTTCATGCAGTGCATCATTGAGAAGGAGAACAACTT
CAAGCAACCTGGAGAGAGATACAGATCCTGGGCACCAGACAG
GTAAACCATGCATCTGCTGTTACTTTCTGATAACTGAATAAACTATAGCACTGATCATGCATGTTCTTCCTTAATCTT
CTCTTTCTTTATCCCCAGGCAAGAACGTTTCGTTCGCAGATGGGTTGATGCCTTGTCCGAACCGCGTGTCACACATGAGGTTCGCAGCATCTGGATCTCATACTGGTCTCAGGTAAAACT
CCCCTTTTACAACAATGTAGTGTCATGTATACCGGATCTCTATAGACACTTTTTCACTGCAAATGCAATTCTGGCAATGATGTGATGCAGGCTGATAAATCTTTGGGCCAGAAGCTAGCA
TCTCATCTCAATGTGAGACCAAGCGTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGCACCGTCCATCAAGCGCTTTCAATTCTCCATACTGGACTACAAATTCTGGTGCTTCGGTCTGGAACAACAACTCTTCTTTGACCGTTGGATCTAGAGGTCCAATC
CTGCTTGAGGATTACCATCTGGTGGAGAAGATTGCCAATTTTGACAGGGAGAGGATTCCAGAGCGTGTTGTCCATGCTAGGGGAGCCAGTGCAAAGGGTTTCTTTGAGGTTACCCACGAT
ATCTCTAACCTCTCATGTGCTGATTTTCTTCGGGCCCCAGGAGTTCAGACGCCTGTAATTGTCCGCTTCTCCACAGTTATCCATGAACGTGGCAGCCCTGAAACCCTGAGGGATCCTCGT
GGTTTTGCAGTGAAGTTTTACACCAGAGAG
GGCAACTTTGATCTTGTGGGAAACAATTTCCCTGTCTTCTTCGTCCGTGATGGAATGAAATTCCCAGACATGGTACATGCCCTTAAGCCC
AACCCCAAGTCTCACATTCAGGAGAACTGGAGGATTCTCGACTTCTTCTCCCACCATCCTGAAAGTTTGCACATGTTCTCCTTTCTCTTTGATGATTTGGGTGTTCCACAAGATTATAGA
CACATGGAAGGCGCTGGTGTCAACACCTACACGCTGATCAACAAGGCTGGAAAGGCAAACTATGTGAAATTTCATTGGAAACCTACTTGTGGTGTGAAATGTTTGTTAGAGGACGAGGCA
ATTAAAGTTGGAGGTGCAAATCACAGTCATGCCACTCAAGATCTATACGACTCAATTGCAGCTGGCAACTATCCTGAGTGGAAACTTTTCATCCAGACAATCGATCCCGACCATGAAGAC
AGGTTTGATTTTGACCCACTTGATGTAACAAAGATCTGGCCCGAGGATATCCTGCCCCTGCAGCCAGTTGGTCGCTTGGTCTTGAATAAGAATATCGATAACTTCTTTGCTGAAAATGAG
CAGCTTGCTTTCTGCCCTGCTATTGTGGTTCCTGGTATTTACTATTCAGATGACAAGCTTCTCCAGACTCGAATCTTCTCCTATGCTGATACCCAGAGGCACCGTCTTGGACCAAACTAT
CTGCAACTCCCAGTTAATGCTCCCAAGTGTGCTCATCACAACAATCATCATGAAGGTTTCATGAATTTCATGCACAGGGATGAGGAG
GTCAACTATTTCCCATCAAGGCATGATCCATCT
CGTCACGCTGAGAGATTCCCCATTCCTTCTGCTGTCTGCAGTGGAAGGCGTGAGAAG
TGCATCATTGAGAAGGAGAACAACTTCAAGCAACCTGGAGAGAGATACAGATCCTGGGCACCA
GACAG
GCAAGAACGTTTCGTTCGCAGATGGGTTGATGCCTTGTCCGAACCGCGTGTCACACATGAGGTTCGCAGCATCTGGATCTCATACTGGTCTCAGGCTGATAAATCTTTGGGCCAG
AAGCTAGCATCTCATCTCAATGTGAGACCAAGCGTCTGA

Retrieve as FASTA