Entry information : PtKat03 (POPTR_0005s10340 / Potri.005G100400)
Entry ID 5157
Creation 2007-04-08 (Christophe Dunand)
Last sequence changes 2010-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtKat03 (POPTR_0005s10340 / Potri.005G100400)
Name (synonym) PtKat03 (POPTR_0005s10340 / Potri.005G100400)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtKat03
start..stop
S start..stop
PdelKat02 1027 0 1..492 1..492
ThasKat03 972 0 1..492 1..492
ThasKat02 967 0 1..492 1..492
AlyKat02 962 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7670205..7670219 15 N° 2 7670421..7670517 97 N° 3 7670735..7671012 278 N° 4 7671416..7672192 777
N° 5 7672288..7672377 90 N° 6 7672637..7672704 68 N° 7 7672810..7672903 94 N° 8 7673120..7673179 60
join(7670205..7670219,7670421..7670517,7670735..7671012,7671416..7672192,7672288 ..7672377,7672637..7672704,7672810..7672903,7673120..7673179)


exon

Literature and cross-references PtKat03 (POPTR_0005s10340 / Potri.005G100400)
Literature JGI.
DNA ref. Phytozome 12:   Chr05 (7670205..7673179)
Omic ref. ePlant:   Potri.005G100400
Protein sequence: PtKat03 (POPTR_0005s10340 / Potri.005G100400)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56795.4  
PI (pH):   %s   7.58
Sequence 533
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSSYNSPFFTTNSGAPVWNNNSSLTVGSRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTNDISHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNFDLVGNNFPVFFIRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLLDDIGVPQDYRHMEGSGVNTYTLINKAGKAYYVKFHWKPTCGVKSLLEDEAIKVGGSNHSHATQDLYDSIKAGNYPEWKLFIQIIDPADEDKFDFDPLDVTKTWPEDILPLMPVGRLVLNKNIDNFFAENEQLAFCPAIIVPGIYYSDDKLLQTRIFSYADTQRHRLGPNYLQLPANAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRFDPVRHAERYPNPSVIHTGKREKCIIEKENNFKQPGERYRSFSPDRKERFVRRWVEALSDPRVTYEIRSIWISYWSQADKSLGQKLASHLNMRPSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns), NO EST. Contig position: 187299-190278.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATCCTTACAAGGTTCTTATTCTACCCGTCTCCCTCTTCAAAACAAATTCATGTCTCTGCTTAATACAAGTAAAAAAAAAATGATGTGTTTAATTTTCTGGTCTGAAATTCACATATA
TTCCTGTTAAATATGTTTCAAACTCTCTTTGATTTTCGTTGTTGGGTACTCTATACAGTTTTGATGTCTCTTTTTGATGCGTTTTCATGATGCAGTATCGTCCATCAAGTTCTTACAACT
CTCCGTTCTTCACTACAAATTCTGGTGCTCCAGTTTGGAATAATAACTCATCGCTTACTGTTGGTTCCAGAG
GTAAAAGTTTGTCATGCTTTTTGGACCTCTTTCATGTCTGAGTTCATT
ATAGAGTGCTTTAGGTGATGGCTTGAGCTTTAGTGAGGTATTTTTACACCTTTTGGTTGATTTGGGTTTTGTAGTTTCTAATTCAGCTTACTTGCGATGCATTGAAACCAAGTTAGTTTG
TGAATACTATGCAAATCTCAGAGTTTGAAGTAGAACTTCTCTTTTGAAGGTCCGATTCTGCTTGAGGACTATCATTTGGTGGAGAAACTTGCTAATTTTGACAGGGAAAGAATCCCAGAG
CGTGTTGTTCATGCTAGAGGTGCGAGTGCTAAAGGGTTTTTTGAAGTGACCAATGATATATCTCATCTCACTTGTGCTGATTTCCTTAGAGCCCCTGGAGTCCAGACCCCTGTTATTGTC
AGGTTTTCTACTGTTATCCATGAACGCGGCAGTCCTGAAACTCTAAGAGACCCCAGAGGTTTTGCTGTGAAATTCTACACTAGAGAG
GTAACAATATTTTTCTGTTTTTTGTTCAAGGAC
TTCTTCTTGTTTTTTCTCTTCCTCTTTGTACTGAAAAATCACAGAAGTAGGTAATTGGTATCGTATATCTGTTGGCAGTCTATCATTTATGTTGCATCAATAACTCAGAATGTTCTTGCT
GTTATCTTGCCTTTAAATTTTAAAAGGATGCCCCCCCCCCCCGCAATTCATTGTGAGATTCTATCAATATGACATGCTTAATGCATGCGGAGGGTGTTGCTTATGATGTGTTTGTTTATC
AATACATGACGGAAAACCTGATCAATGCATATCATAGTAACATGCCTCCCGTTGTAAAATTGGAATTGACTGTGCATTAGAAGTTATTGACTGAAAGGTTCAATGAATTCTGTTTCACCG
CTCTCACCAGGGAAATTTTGATCTGGTCGGCAACAATTTCCCAGTCTTCTTCATTCGTGATGGGATGAAGTTCCCTGATATGGTTCATGCTCTCAAGCCCAACCCTAAATCACACATTCA
GGAAAACTGGAGGATACTTGACTTCTTCTCACACCATCCCGAGAGCTTGCACATGTTCTCCTTCCTGCTTGATGACATTGGTGTTCCACAAGATTACAGGCACATGGAAGGCTCTGGTGT
TAACACCTATACTCTAATCAACAAGGCTGGGAAGGCATATTATGTGAAATTCCACTGGAAACCAACATGTGGGGTCAAGTCTTTATTGGAAGACGAGGCCATAAAAGTTGGCGGATCCAA
TCACAGTCATGCCACACAGGATCTCTATGACTCCATCAAGGCTGGAAACTACCCTGAGTGGAAGCTTTTCATTCAAATAATTGATCCAGCTGATGAAGACAAGTTTGACTTTGACCCACT
TGATGTAACCAAGACTTGGCCTGAAGACATCTTGCCTTTGATGCCTGTGGGCCGCTTGGTGTTGAACAAGAATATTGATAACTTCTTTGCGGAGAACGAGCAGCTAGCATTTTGCCCTGC
TATTATAGTGCCTGGTATCTACTATTCGGATGATAAGTTGCTGCAAACTAGAATCTTCTCGTATGCTGATACTCAGAGGCACCGCCTTGGGCCAAATTATCTCCAGCTTCCAGCAAATGC
TCCAAAGTGTGCTCATCACAACAATCACCATGAAGGTTTCATGAATTTTATGCATAGGGACGAGGAG
GTACACTCTCTCTCTCTCTCTGAGCTCATGTATACGCTACTTTTTTGTACTTA
ATGCTATCCTAGGATCATTATCTGATAAGGGCTTGTTTTTAGGTCAATTACTTCCCCTCAAGGTTTGATCCTGTCCGTCATGCTGAGAGATACCCTAATCCTTCTGTCATTCACACTGGC
AAGCGTGAGAAG
GTTTGTATCTCTATTTCCTTCAGTGTTTTGAATATTGAAGGGTGGTAAGTAGGCTGGTTTTGGGTTAGAATTGAGCTGTGGTTTCAGAGAGCCAGTGAAAATGTATTC
CGCGATACCTTCTAACCCTGCAACTGAACTGATGCTTTCATGATACTCTGGGTTGCTTTATCTGTATCAAGAGTGTTAGCTCTTAATTATCCCACTGAACTAATTTATCTTTGTATAATT
CTGTGCTGTCCGTCTCTCTTCATTATCACAGTGCATAATTGAGAAGGAGAATAACTTCAAGCAGCCTGGCGAGAGATACCGTTCATTTTCACCAGACAGGTATCCTTATCTTGTGATTTC
TGAGACATTCATCATGTTTTAGATTCCAATATAACAAACTAAGTCCTTTGTTCTTTAATTTTCCTTTTTGATTTACTTTTTCAGGAAAGAGCGCTTCGTTCGCCGTTGGGTTGAGGCCTT
GTCTGACCCAAGGGTTACATATGAAATCCGCAGTATTTGGATATCATACTGGTCTCAG
GTGAAGTTTCCATCCCCATGCAAACATTTATACTCATATCAATCTCCTGATTGGATGAATGA
ATATTTTTCACTATATATAAAATGCATGAGTTCTGTGTTGCCATCTACTTTTTTGGTTGATGTTAAGCTGATTATATAGTTGTATCGCTATAGTTCATTTTAGTTTTCAGATGGCATAAA
CCAATTATTACTACATTATTTTGTTTGGTTACAGGCTGACAAGTCTCTGGGTCAGAAGCTTGCTTCTCACCTCAATATGAGGCCAAGCATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATCCTTACAAGTATCGTCCATCAAGTTCTTACAACTCTCCGTTCTTCACTACAAATTCTGGTGCTCCAGTTTGGAATAATAACTCATCGCTTACTGTTGGTTCCAGAGGTCCGATTC
TGCTTGAGGACTATCATTTGGTGGAGAAACTTGCTAATTTTGACAGGGAAAGAATCCCAGAGCGTGTTGTTCATGCTAGAGGTGCGAGTGCTAAAGGGTTTTTTGAAGTGACCAATGATA
TATCTCATCTCACTTGTGCTGATTTCCTTAGAGCCCCTGGAGTCCAGACCCCTGTTATTGTCAGGTTTTCTACTGTTATCCATGAACGCGGCAGTCCTGAAACTCTAAGAGACCCCAGAG
GTTTTGCTGTGAAATTCTACACTAGAGAG
GGAAATTTTGATCTGGTCGGCAACAATTTCCCAGTCTTCTTCATTCGTGATGGGATGAAGTTCCCTGATATGGTTCATGCTCTCAAGCCCA
ACCCTAAATCACACATTCAGGAAAACTGGAGGATACTTGACTTCTTCTCACACCATCCCGAGAGCTTGCACATGTTCTCCTTCCTGCTTGATGACATTGGTGTTCCACAAGATTACAGGC
ACATGGAAGGCTCTGGTGTTAACACCTATACTCTAATCAACAAGGCTGGGAAGGCATATTATGTGAAATTCCACTGGAAACCAACATGTGGGGTCAAGTCTTTATTGGAAGACGAGGCCA
TAAAAGTTGGCGGATCCAATCACAGTCATGCCACACAGGATCTCTATGACTCCATCAAGGCTGGAAACTACCCTGAGTGGAAGCTTTTCATTCAAATAATTGATCCAGCTGATGAAGACA
AGTTTGACTTTGACCCACTTGATGTAACCAAGACTTGGCCTGAAGACATCTTGCCTTTGATGCCTGTGGGCCGCTTGGTGTTGAACAAGAATATTGATAACTTCTTTGCGGAGAACGAGC
AGCTAGCATTTTGCCCTGCTATTATAGTGCCTGGTATCTACTATTCGGATGATAAGTTGCTGCAAACTAGAATCTTCTCGTATGCTGATACTCAGAGGCACCGCCTTGGGCCAAATTATC
TCCAGCTTCCAGCAAATGCTCCAAAGTGTGCTCATCACAACAATCACCATGAAGGTTTCATGAATTTTATGCATAGGGACGAGGAG
GTCAATTACTTCCCCTCAAGGTTTGATCCTGTCC
GTCATGCTGAGAGATACCCTAATCCTTCTGTCATTCACACTGGCAAGCGTGAGAAG
TGCATAATTGAGAAGGAGAATAACTTCAAGCAGCCTGGCGAGAGATACCGTTCATTTTCACCAG
ACAG
GAAAGAGCGCTTCGTTCGCCGTTGGGTTGAGGCCTTGTCTGACCCAAGGGTTACATATGAAATCCGCAGTATTTGGATATCATACTGGTCTCAGGCTGACAAGTCTCTGGGTCAGA
AGCTTGCTTCTCACCTCAATATGAGGCCAAGCATTTGA

Retrieve as FASTA