Entry information : GmPrx29 (Glyma20g38590.1)
Entry ID 516
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx29 (Glyma20g38590.1)
Name (synonym) GmPrx29 (Glyma20g38590.1)
Class Class III peroxidase    [Orthogroup: Prx313]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Roots hairs
Roots of 'Supernod' plants
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx29
start..stop
S start..stop
MtPrx39 485 8e-174 24..349 2..323
AhPrx04 439 6e-156 35..347 7..316
EgrPrx167 432 5e-153 34..347 7..320
ShPrx06-1B 431 7e-153 35..347 9..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46140917..46141207 291 N° 2 46140432..46140623 192 N° 3 46140170..46140335 166 N° 4 46139455..46139870 416
complement(join(46139455..46139870,46140170..46140335,46140432..46140623,4614091 7..46141207))


exon

Literature and cross-references GmPrx29 (Glyma20g38590.1)
Literature Public Soybean EST Project, Scheffler,B.E.,et al Expressed sequence tags from soybean root hair subtractive cDNA library.
DNA ref. Phytozome 12:   Gm20 (46141207..46139455)
Protein sequence: GmPrx29 (Glyma20g38590.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355
PWM (Da):   %s   38869.63 Transmb domain:   %s   i13-32o
PI (pH):   %s   8.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAITHPTYIFLKPLLVEVPFAMAAISSLSLFFKLKFSLILISCVIGVTSAQLSSKFYDKSCPKALTTIRKEVERAVRNESRMGASLLRLHFHDCFVQGCDASVLLDDTANFTGEKNSFPNANSLRGFEVIDNIKSKLEGMCKGVVSCADILAVAARDAVVALGGQKWEVQVGRRDSTTASLDEANSDLPAPFLDLSGLITAFAKKNFTTQELVTLSGGHTIGLVRCRFFRARIYNESNIDPTFAQQMQALCPFEGGDDNLSPFDSTTPFKFDNAFYKNLVQLKGVVHSDQQLFTNNGSGPTNDQVNRYSRNMGNFKKDFADAMFKMSMLTPLTGSNGQIRQNCRLVNPPSTTVS*

Retrieve as FASTA  
Remarks TIGR complete sequence from genomic and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATAACCCACCCAACATATATATTCTTAAAACCTCTACTAGTAGAAGTACCCTTTGCAATGGCTGCAATAAGTTCTCTCTCTTTGTTCTTCAAACTAAAGTTTTCGTTGATTTTA
ATTTCATGTGTTATCGGGGTAACTTCAGCTCAGTTATCCTCAAAATTCTATGATAAAAGTTGTCCCAAAGCCCTTACCACCATTAGGAAAGAAGTGGAACGTGCTGTGCGCAATGAGAGT
CGCATGGGGGCCTCCTTGCTCCGACTACACTTCCATGACTGCTTCGTTCAA
GCAAGTCTCATTTCACTCTTAACATCTTTATATATATTTGCATAAGTATCTTACATTCAAATTAAAATA
ACTCTATTGCCTACTACTACATTAATACTATATAGTATATATTCACCATGTGATTGTGGATGTTGTGTGTTGCATGTTTACAATGTTATTAATTCTTTTTCGTAAATTAAAAAAAAAATT
CAAGATTACGTGTAACATAGAAATTGACTGATCAGATGACATTGAACATGAAAAGTTAATAGTGTGTTTGTTATAAGAAACTGATATTCTGTTTTGACTTACAGGGATGTGATGCATCGG
TGTTGTTAGACGACACGGCAAATTTCACTGGCGAGAAGAACTCATTTCCTAATGCTAACTCCCTTAGGGGTTTTGAAGTCATAGACAACATAAAATCTAAGTTGGAAGGCATGTGTAAAG
GTGTTGTCTCTTGTGCTGACATCTTAGCCGTTGCTGCGAGAGACGCTGTTGTTGCT
GTAAGTACTTACTAATTACTATCTAATTCAATTGATCATATTATTATGATGAAATTAAAGAAAG
TGATGTAAGAAAACTTTAACTAATTGTCTCAGCTTGGTGGACAAAAATGGGAAGTACAAGTAGGCAGAAGAGATTCAACCACAGCAAGTTTAGACGAAGCCAATTCAGATTTACCAGCTC
CCTTTTTGGATCTTAGTGGCCTCATCACTGCTTTCGCCAAGAAAAATTTCACTACCCAAGAACTTGTTACTTTATCAG
GTAAAATTAATTGCCTAACATACTTAGTTACAACATTACCTT
TTGTACGAGTAAATTAACTAGTATTTTTTTTTTTTTTGACAAATGTTAGTTTGTTAATTTTATTAGAAATTTCATTTTTCTCCTTCCTTCATCTTTCAACTATTTGATCAAACCTTATAT
CACCAAGCAAATTAACTAGTGTATATATATATAGAATATATAGAACTGCTATATATAGTTAAAATGATTGTTATAATCAATCTTAATTTGTGCAAAGAATAATGACCCTTTTGAATTATC
TTCTTTATAATGTTCAGGTGGTCACACAATCGGACTAGTTAGATGCCGTTTCTTCAGAGCGAGGATTTACAACGAGAGCAACATAGATCCGACATTTGCACAACAAATGCAAGCATTGTG
TCCCTTCGAAGGTGGTGATGACAATTTGTCTCCTTTCGATTCCACCACACCATTCAAATTTGACAATGCATTCTACAAGAACTTGGTGCAGCTAAAGGGTGTAGTACACTCGGACCAACA
ACTCTTCACGAACAATGGATCTGGTCCCACAAACGATCAAGTAAATAGATACAGCAGAAACATGGGAAATTTCAAGAAGGACTTTGCAGATGCAATGTTTAAGATGAGCATGCTCACCCC
ACTAACTGGCTCCAACGGTCAGATTAGGCAAAACTGCAGGCTAGTCAATCCACCATCAACCACTGTCTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATAACCCACCCAACATATATATTCTTAAAACCTCTACTAGTAGAAGTACCCTTTGCAATGGCTGCAATAAGTTCTCTCTCTTTGTTCTTCAAACTAAAGTTTTCGTTGATTTTA
ATTTCATGTGTTATCGGGGTAACTTCAGCTCAGTTATCCTCAAAATTCTATGATAAAAGTTGTCCCAAAGCCCTTACCACCATTAGGAAAGAAGTGGAACGTGCTGTGCGCAATGAGAGT
CGCATGGGGGCCTCCTTGCTCCGACTACACTTCCATGACTGCTTCGTTCAA
GGATGTGATGCATCGGTGTTGTTAGACGACACGGCAAATTTCACTGGCGAGAAGAACTCATTTCCTAAT
GCTAACTCCCTTAGGGGTTTTGAAGTCATAGACAACATAAAATCTAAGTTGGAAGGCATGTGTAAAGGTGTTGTCTCTTGTGCTGACATCTTAGCCGTTGCTGCGAGAGACGCTGTTGTT
GCT
CTTGGTGGACAAAAATGGGAAGTACAAGTAGGCAGAAGAGATTCAACCACAGCAAGTTTAGACGAAGCCAATTCAGATTTACCAGCTCCCTTTTTGGATCTTAGTGGCCTCATCACT
GCTTTCGCCAAGAAAAATTTCACTACCCAAGAACTTGTTACTTTATCAG
GTGGTCACACAATCGGACTAGTTAGATGCCGTTTCTTCAGAGCGAGGATTTACAACGAGAGCAACATAGAT
CCGACATTTGCACAACAAATGCAAGCATTGTGTCCCTTCGAAGGTGGTGATGACAATTTGTCTCCTTTCGATTCCACCACACCATTCAAATTTGACAATGCATTCTACAAGAACTTGGTG
CAGCTAAAGGGTGTAGTACACTCGGACCAACAACTCTTCACGAACAATGGATCTGGTCCCACAAACGATCAAGTAAATAGATACAGCAGAAACATGGGAAATTTCAAGAAGGACTTTGCA
GATGCAATGTTTAAGATGAGCATGCTCACCCCACTAACTGGCTCCAACGGTCAGATTAGGCAAAACTGCAGGCTAGTCAATCCACCATCAACCACTGTCTCCTGA

Retrieve as FASTA