Entry information : VvAPx01 (GSVIVT01025104001 / Vitvi12X-PACid_17833160)
Entry ID 5169
Creation 2009-02-27 (Christophe Dunand)
Last sequence changes 2009-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-29 (Christophe Dunand)
Peroxidase information: VvAPx01 (GSVIVT01025104001 / Vitvi12X-PACid_17833160)
Name (synonym) VvAPx01 (GSVIVT01025104001 / Vitvi12X-PACid_17833160)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Vitaceae Vitis
Organism Vitis vinifera (Grape)    [TaxId: 29760 ]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VvAPx01
start..stop
S start..stop
VhAPx01 513 0 1..250 1..250
GrAPx01 469 2e-170 1..250 1..250
GhAPx02 466 2e-169 1..250 1..250
SbAPx01 464 1e-168 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4446242..4446360 119 N° 2 4445962..4446136 175 N° 3 4444090..4444155 66 N° 4 4442561..4442609 49
N° 5 4442354..4442439 86 N° 6 4442146..4442225 80 N° 7 4441921..4442023 103 N° 8 4441752..4441810 59
N° 9 4441617..4441632 16  
complement(join(4441617..4441632,4441752..4441810,4441921..4442023,4442146..4442 225,4442354..4442439,4442561..4442609,4444090..4444155,4445962..4446136,4446242. .4446360))


exon

Literature and cross-references VvAPx01 (GSVIVT01025104001 / Vitvi12X-PACid_17833160)
Literature Velasco,R., et al., The first genome sequence of an elite grapevine cultivar (Pinot noir Vitis vinifera L.): coping with a highly heterozygous genome
DNA ref. Phytozome 12:   chr6 (4446360..4441617)
Cluster/Prediction ref. UniGene:   Vvi.22187   Vvi.8087
Protein sequence: VvAPx01 (GSVIVT01025104001 / Vitvi12X-PACid_17833160)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27469.05  
PI (pH):   %s   6.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSEEYKKAVEKAKKKLRGLIAEKNCAPIMLRIAWHSAGTFDVKTRTGGPFGTMKKPEELAHGANNGLDIAVRLLEPIKEQFPIISYADFYLAGVVAVEVTGGPEIPFHPGREDKPEPPPEGRLPDATKGCDHLRQVFVTQMGLSDKDIVALSGAHTGRCHKERSGFEGPWTSNPLIFDNSYFKELLSGEKEGLLQLPSDKALLSDPAFRPLVEKYADEDAFFEDYKEAHLKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 6, 7 introns) and 226 ESTs (2 unigenes). Cultivar="Pinot Noir" and "PN40024". Also found in AM469600 (Contig end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTATCCTACTGTGAGCGAGGAATACAAAAAGGCTGTAGAAAAAGCCAAGAAGAAGCTCAGAGGCCTCATCGCTGAGAAGAACTGTGCTCCGATTATGCTCCGAATCGCG
TACGTCCTTTCTCTCTAAGATCTCAATAGTTGTTTTTCCCAGTTATTTGTTCGTTTATCTATTTATTTTACCAGGATGTTGACCGTGTAATCATGTGGTTTCAGATGGCACTCTGCCGGT
ACCTTCGATGTGAAGACGAGAACCGGAGGTCCTTTCGGAACGATGAAGAAGCCAGAAGAGCTAGCTCACGGAGCCAACAACGGTCTTGATATAGCCGTTAGGCTCTTGGAACCTATCAAG
GAACAATTCCCTATCATTTCGTACGCTGACTTCTATCAG
GTATTATAAATACTTGCAATTTTTTTCCTAGCTTCCTCTTTTCCCTTTGTTAATTTTCGTTTTGATCCTTTTCGTTTGCAA
GAAACACGTTTAGGAAAATGAAAGAGAAAATATATATATATATGGATATATTTGTAAACGGACGCTAATTTTTTGCTTGGCTCTTAAAAGCTGCTGTAAATCTGATGGCCTCTTGGTTTG
CTTGTTCACTTCAAACGTCAGTGGACGTGAGAATTTGTTTTGCATATTAATGTTTAGGATTCAACCAAATAGGTCGGTCAGATGGGATAATGGCAGCCACTTATTTATCAAATTCCCTCG
AGGAACTAACTTCTGAGACATTAACTTTACCTTTTGTCAATTTTTTTCCCATTACTCCTTTCTTCCTTAGAGTTAAACTTTACCCTACAATTCACCATGCTTAAGCTTATGTGGGTTGAA
AAGAATAGGAAAGTCAAAGGATAACTAATACAAATTTATATAATTTTTTTAATTTCATTATTAGAAATTAGATTATTTGAAATATACTTTTCTCATTTAAAAAAAGAATTGAGATTTTTA
TTAAATAAAAACCAATCCCAAGGGTTAATATGCTACTTTATGCATGTAACAACAAACTTTAGCAATTGCTTATAGCTACGTAAAAGCTTTGTTGCCCTAATTGAATAAACAGTTAATTTT
TATGTGTGCTTTATTTTTCATGAGCATCTCAATTCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTATTTTGATTTATGAAATTTTGTCCACTTTAACTAAAGGATAGTTATGAAATTTTGGTTTATTATTTTGCTA
AATGGCCTTTGTGGAAATTTTCCCCCCTTTGTCTTGTCCTTAACCAGAATTATCAAAATTGCTATCCCTTTTGGGCCATTATCACACCTATCCCACTCTATTCAATAATTTTTCTTTTAT
GCTTTCAGACATTGACTTTTCTTTTTCATTTTCTATGTTACTTAGTTGGCTGGAGTTGTTGCTGTTGAGGTCACTGGAGGGCCTGAAATTCCTTTCCACCCAGGGAGAGAGGTAGGTGAA
TTATCACCATTCTTTCATTTCAGTTAAAATTGCATATTCTTTTTAAAGAAAAAACTTTTAAGTTCTAACTATTTAGTTGATCTGTTGCTGTAATATGTTGCTTAGGATTGTCTTGTCCTC
CTTTTTATTTATGTTTTCCTTACCAGACTATCTCTGTTATATTCCATATTTAAAATTAGGACAAGGAAGTAGTTCTGTATAACAGTTCAATTTTGTGATTGTTTTGATCTAGATAAGTTT
TGTATGGGTTGAATCAAAAACTGAAATTTGGTGGGTTGGAGCTGGGCATCCTACCTTTTGCTTACTAGGTTCATGTATTTTAATAGGTTGTAGTGAAAATTTGATGTGGAGCAGATATCA
TAGTCACCACATAATGCTTTGGTGGTAGCGGTGTTTGCATTGTTTCTTAATGCTACATTGCAAACTTATTAGTTGATATTAAAGCTTGGTAACCTAGAGCTTGCAATATGGTTGTCTAAT
TTGTCTGGATTCTAACTTCGCCTGCTTTAAAGCTTATATGATGCACTAATTTGTCCATATGCCTCTGGCAGATAACCAATGGATTGGTCTGAATACTTGGTAGAACCTATATTTTTAAAT
ACAGCATGGCCTATTCACTCAGTTTTGGGACTGTGGCCCGAATCACAATGTTTCTATAAGCATGTTTTGTTTGATCTATTACTTTAAGAGGTGTAGATGCCATGTAAACTTCAATGCATG
TATCTGACATGTCTTTATTTTGTTTTATTGGTCTGTCTTTCCTTTTATGGGGGAAATGTGGTTTTTGATGCCAAATTATCAAGATTTTGGGTATTTGGGTATTTCCTTTTCTGCTTTATG
TAAAGTCATTGTCCTTTGAAAGGGGAAAAATCTTAATTAATTTCTCTACAAAAAAGAACAGTACTTCTAAAGTCGTTTTCAGACAGCATTTGTCTGACAAAAAAAAAAAAATGAAACGAA
TGTAATTATATTTCTATTCTAGTGGATTGGGGTTTTTGCATGGAGAATGGCAAAAACCACAGCAATTGATCAAAAGGAGTTTAAAATGTGTTCCAAAGCCAGTGTCCATTTTTATTTATT
TGTATAAAATTTTTCCCTAAAAATTTTCTGTTCTTTTTTTACTGATTTTGTTTGGTTCATTGTAAAAGTGCCATTGGAGAAAAAAAAATCATGTGTCTTTTCCCCTTTTTCTTCTGGGGC
CTTTTCTTTTCTTTGTTTAAACGGTATACATGATTTGCTTGTTTTTTTCAATTTTATCCTTTTCTTCTCATGATGCCACTATTCCTTTGTGGCAGATTAGAACAGATCTACATGATGGTG
GACCTCCAAGTTTAGTTAAAATATTGTCCTACATCTATTCTCTATTTATATTCTGATTCTTGATAGATGTTACAATTTTGTATTCTCTTCATTTATCATAATGTATTTATCTTGTTATTT
TATGCTGACAATGGTCCTCCTCTTATCTCAGGACAAGCCGGAGCCACCACCTGAGGGTCGTCTGCCAGATGCCACCAAAGGTTAGTATGTTTAAAACCTTATTTGCATCATGTTGTATGT
TGAAAAGAAAAAAATCAAAACTTACTGGGAGAAGATGTATTGAGTTAAGAAGTTTATGTGGGTGAATCAACTGATGTGCAGGATGCGATCACTTGAGACAGGTGTTTGTTACTCAAATGG
GTCTCAGCGACAAGGACATCGTAGCTCTCTCTGGGGCCCACACCCTG
GTCTGTGTTCAGTTTTACAGTTATTCACACTTAATGAGTGCTGGCAAGAATTGTATTCAGTCAGTTTTAACAT
CTTACCATAATTGTGATCTGAAATTGAAAGATGCTGGTTGGTTTTATGTTTGCAGGGAAGGTGCCACAAGGAGCGCTCTGGATTTGAAGGACCCTGGACCTCCAACCCTCTGATCTTTGA
TAACAGCTACTTCAA
GTGAGTTTTGTGTTCTTCTCCCTATACATTCTTTAATAGTTCTAGCTTTTGCCTGGTTATAAGACTCTTCTATGCATCTTAAGAATGTTTGCTTATTTTGTTATT
ATTTGACTTGTCAACAGGGAACTCCTTAGCGGAGAAAAGGAAGGTCTTCTACAGCTGCCAAGTGATAAAGCTCTTCTCTCAGACCCAGCCTTCCGTCCTCTTGTTGAGAAATATGCCGCT
GTCAGTAATTGCTCTGCTTATCTTCATTTCAAGTTCCCAACAATATAAGAATTTAGCTGGATTTTGATGATTTGGAAAAAACTTAAGTTGTGGCTATGATATCTTTTCAGGATGAAGATG
CCTTCTTTGAGGATTACAAAGAAGCCCATTTGAAGCTCTCTGAGCTGGG
GTAACATTTCCTATCTAAGTTCTATATTTGCCATATCATGGAGTTTTCCCCAGAACATTGTTATTGTTATG
TAACCGGACCAGAGGACTAAGTTTCTTTCCTATTTTCATCACTTGCAGATTTGCTGATGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTATCCTACTGTGAGCGAGGAATACAAAAAGGCTGTAGAAAAAGCCAAGAAGAAGCTCAGAGGCCTCATCGCTGAGAAGAACTGTGCTCCGATTATGCTCCGAATCGCA
TGGCACTCTGCCGGTACCTTCGATGTGAAGACGAGAACCGGAGGTCCTTTCGGAACGATGAAGAAGCCAGAAGAGCTAGCTCACGGAGCCAACAACGGTCTTGATATAGCCGTTAGGCTC
TTGGAACCTATCAAGGAACAATTCCCTATCATTTCGTACGCTGACTTCTATCAG
TTGGCTGGAGTTGTTGCTGTTGAGGTCACTGGAGGGCCTGAAATTCCTTTCCACCCAGGGAGAGAG
GACAAGCCGGAGCCACCACCTGAGGGTCGTCTGCCAGATGCCACCAAAGGATGCGATCACTTGAGACAGGTGTTTGTTACTCAAATGGGTCTCAGCGACAAGGACATCGTAGCTCTCTCT
GGGGCCCACACCCTG
GGAAGGTGCCACAAGGAGCGCTCTGGATTTGAAGGACCCTGGACCTCCAACCCTCTGATCTTTGATAACAGCTACTTCAAGGAACTCCTTAGCGGAGAAAAGGAA
GGTCTTCTACAGCTGCCAAGTGATAAAGCTCTTCTCTCAGACCCAGCCTTCCGTCCTCTTGTTGAGAAATATGCCGCT
GATGAAGATGCCTTCTTTGAGGATTACAAAGAAGCCCATTTG
AAGCTCTCTGAGCTGGG
ATTTGCTGATGCCTAA

Retrieve as FASTA