Entry information : MdAPx-R
Entry ID 5191
Creation 2007-04-13 (Christophe Dunand)
Last sequence changes 2011-05-03 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2011-07-28 (Catherine Mathe)
Peroxidase information: MdAPx-R
Name MdAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Malus
Organism Malus domestica (apple tree)    [TaxId: 3750 ]
Cellular localisation N/D
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MdAPx-R
start..stop
S start..stop
PpeAPx-R 505 0 26..323 19..319
CclAPx-R 418 7e-148 5..323 3..335
CsAPx-R 417 3e-147 5..323 3..335
VvAPx-R 414 2e-146 31..323 23..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7945..8113 169 N° 2 8212..8314 103 N° 3 8393..8520 128 N° 4 8811..8881 71
N° 5 9042..9084 43 N° 6 9167..9263 97 N° 7 9497..9580 84 N° 8 9809..9924 116
N° 9 10377..10434 58 N° 10 10949..11051 103  
join(7945..8113,8212..8314,8393..8520,8811..8881,9042..9084,9167..9263,9497..958 0,9809..9924,10377..10434,10949..11051)


exon

Literature and cross-references MdAPx-R
Literature Korban,S., Vodkin,L., Liu,L., Gasic,K., Gonzales,O., Hernandez,A., Aldwinckle,H., Malnoy,M., Carroll,N., Goldsbrough,P., Orvis,K., Clifton,S., Pape,D., Marra,M., Hillier,L., Martin,J., Wylie,T., Dante,M., Theising,B., Bowers,Y., Gibbons,M., Ritter,E., Ronko,I.,Tsagareishvili,R., Kennedy,S., Waterston,R. and Wilson,R. Apple Functional Genomics grant - NSF 0321702
DNA ref. GenBank:   ACYM01051383.1 (7945..11051)
EST ref. GenBank:   CX025415 [Fragment]
Protein sequence: MdAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323
PWM (Da):   %s   34658.65  
PI (pH):   %s   6.37
Sequence 364
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPITSTVALLCSSTPSIFTPSYSTTFPFNFNFPAKSLSTVNFHANPLPAVKAATSGKDHVLGRRGLVLTLTATLPWLLPFSECTAAKAAESDGSEYELMKEEIRKVVTKGKAAGVLRLVFHDAGTYQIDDNSGGMDGSIVYELDRPENKGLKTPFKILEKAKSEVEAVHPVSWADMIAVAGAEAVSICGGPTIQVPLGRLDSKEPDPEGKLPEETLDASGLKQSFQTKGFSTQELVALSGAHTIGNKGFGNPTVFDNTYFKILLEKPSSGSMIGLPSDRALAKDDECLSWITKYAADQNMFFNDFKTAYLKLVNSGARWKSL

Retrieve as FASTA  
Remarks Complete sequence from 2 ESTs (CX025415 and CN490022) and genomic (9 introns). Cultivar="GoldRush".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGCCAATTACCTCCACCGTCGCCCTCCTCTGCTCCTCAACCCCGTCCATCTTTACCCCCTCTTACTCCACCACATTCCCGTTCAACTTCAACTTTCCGGCCAAATCCCTCTCAACGG
TCAATTTTCACGCCAATCCTCTTCCCGCCGTCAAAGCCGCCACTTCAG
GTAAAAGCTAACAAAGCCCTAAATTCTCTGTTTGGTTGCTTGGAGGTAAAAGGAAACGCAATTCTATAAATT
GATGCACCAAATGTTGAAAATCTCAGGTAAAGATCACGTCTTGGGCAGAAGAGGACTGGTGCTTACACTTACTGCCACACTGCCATGGCTGCTTCCTTTCTCTGAATGCACGGCGGCGAA
GGCGGCTGA
GTGAGTTGAACAAAATCTCCGATCTTTTCGTTTATTAAGAAATTTAAATATGTGCATAGTAATTACCGCATTTGGAAGGTCGGATGGAAGTGAATATGAGCTTATGAAGGA
GGAGATTAGGAAGGTGGTGACCAAGGGAAAGGCGGCCGGCGTGCTTCGTTTGGTGTTTCATGATGCCGGGACTTATCAAATTGATGACAATTCAG
GTACCGATATCTATATGCATTGACC
ATGCTCCTTACTCATTTCCACTACTCCATTGAATTTTTGAAGTTGGAGTAATTTCAATTGGAGTTAATATTCCTACACTTCCTGTAATACCGGGTATTGTGGGTCGAGGATGTGCGAGTG
GTTGACGTATGTTGCATTGTACAGTCAATTTTCTACGGATATGTTTCGGGTTGAATTGGATCTATTGTCTGTATTTCTTTCAAACTGGGACAAGTGCTCTACTATTACTACAATGCATCT
TCATTGCTGTTGTTAACTATTGCAGGTGGTATGGATGGTTCTATCGTTTATGAACTTGATAGACCGGAAAACAAAGGTCTTAAAACTCCTTTCAAGGCATGCCCCTTCTAAACTCTMTAT
RTAGATGTGTGTCGATTCAATCTTTTGGTTTCCATCGGGTTCCCAATTCTTAATCTTTTGCATAATGATTGAGTAAAGAAATTATTCATATGATCTTTTATCAGCTAACTCTTCGGTGGA
TTGAATTGTTGGTTAGATTCTAGAGAAAGCAAAGAGTGAGGTGGAAGCAGTACACCCAGGTTTTCTATCTAGTGAGATACAGTTGACTAGGTTTTAGTAGTGCCGAGTGCTGTGCTAACA
TGTGGGTGTTTCCAAAACTAGTGTCCTGGGCAGACATGATTGCTGTGGCTGGAGCAGAAGCAGTTTCAATATGTGGAGGTCCTACAATCCAAGTTCCGTTAGGCAGACTAGATTCAAAGT
AAGATGCATCAAGGTGGAAAAAACCAACATCATGCTTGAACCTTTCAATAATTCAGTTGCCAAGTATTGCTAGCGTTAATGCAAACCCTAAAAATAGAAAAAATAGTTTCCAATTCTTGT
AGGAGCATCTATCTAGTGCTACCAAAAGCTATAATTCCTATTTTTAGAAATGATGCTGTGAATAGCTATATCTCTCTATCTCTCATCTTTTCTTCTTTTTTCATTTATTAGGGAGCCTGA
TCCCGAAGGAAAACTTCCTGAAGAAACTCTGGATGCTTCTGGTCTGAAGCAAAGCTTCCAAACAAAAGGCTTCTC
GTAAGTTCATATATGCTAAACGTTTGCAATATTTGGTGGCCGAGG
GTGTGGTTGTTGTTTATATCTAAAATAAACCGGATATGCATGAAGATTAAAGTCCTTGAGATATCAATGGACATTTTATTGATAGATTTACTTAGTTTCTGCATTTAATTGATTTCTGTT
CTAGTTATATGTTTATAGTGACTTGACTTGCTATGGGTTTGAACCATGTATATTTTTTTTCAGAACTCAGGAACTTGTTGCTCTGTCAGGAGCCCATACTATTGGAAATAAAGGTTTCGG
GAACCCAACGGTTTTTGACAATACATACTTCAAAATTCTTCTTGAGAAACCATCTTCAG
GTAAATAACAGCAACATGGATATAAGGTGCTTAATAAAATAGGCTTAAAAAAAAACTCGGG
ATCTCCCTCAAGCTCCTGCTATTGGGGAATTTGTGTTACAGCTTGATAACTGAGCAACAATAGAAAAATAGGAATGCAATGGAGTAATGATGCTCTATTTTTAGAGTGAGTCAACTTTCA
CATTTCTGTTTGATCTTCAATGAATGTATACATATATATATTTTATTTTGATGTACACGTATGCTTTGATCAATTTGCTTGGGCAACATAGACATTTTTTTTGTTCAATGAATGCATCTG
TCATGATATTCACGATATAGTCGAAACAAAGTATTGTGACTTATCTATGTAGCATCTAAAATGAATGACTTGATAGAAAATTATTTTCTCGTCTTGTCAAAATATCAATTTTTTTTGTTT
TGCAATTTCTGATTCTATTCTTTGCATTCAGGTAGCATGATTGGCCTTCCCTCAGACCGTGCACTTGCCAAGGATGATGAATGCTTAAGGTCCATTTCCTTGTAGAAACTTTAATCTGTG
TACTTTTCTCTGTTCTGTCATGTGTTGCTGGGCATTTAAGCCAGTCGACTACTCTACTCAGTTATTCATAGAATATTAAAATGAATATAATCTGGTCAGAAGACTTGAAAAAAAAAAGAG
CCAACAATTTAAACARGAGTTATGCTAGAAAAATCTAAATTTGATGAAAATCAATCCACAAATTCCTCAAAGCGGTTGAGATAATTGTGATCATTCACAATTTCTTTTATGCAAGGGTTC
ATGTTAGGAAATGAATTAAAGATTTTGTCACGGTGAGTTGACGCTACAGTTATGAACATTTTAGAACGATGGCCTCCTTCTTTAATTACTTTGATCTTACACATTTCTCATAAATGCCTG
ATATGTCATGCKCTAGCGATCAGAATTTAGAAAAATGACAGCATCTAATGTTCCATTTTTATGTACGTGTAGTATTTGTTCCTTATTCATATCCAACTGAAGAGAAGCTTGTTTCCTGCA
CAGCTGGATCACAAAGTATGCCGCGGACCAGAATATGTTCTTCAACGATTTCAAGACGGCTTATCTCAAACTAGTGAATTCGGGAGCCAGGTGGAAGAGCTTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGCCAATTACCTCCACCGTCGCCCTCCTCTGCTCCTCAACCCCGTCCATCTTTACCCCCTCTTACTCCACCACATTCCCGTTCAACTTCAACTTTCCGGCCAAATCCCTCTCAACGG
TCAATTTTCACGCCAATCCTCTTCCCGCCGTCAAAGCCGCCACTTCAG
GTAAAGATCACGTCTTGGGCAGAAGAGGACTGGTGCTTACACTTACTGCCACACTGCCATGGCTGCTTCCTT
TCTCTGAATGCACGGCGGCGAAGGCGGCTGA
GTCGGATGGAAGTGAATATGAGCTTATGAAGGAGGAGATTAGGAAGGTGGTGACCAAGGGAAAGGCGGCCGGCGTGCTTCGTTTGGTGT
TTCATGATGCCGGGACTTATCAAATTGATGACAATTCAG
GTGGTATGGATGGTTCTATCGTTTATGAACTTGATAGACCGGAAAACAAAGGTCTTAAAACTCCTTTCAAGATTCTAGAGA
AAGCAAAGAGTGAGGTGGAAGCAGTACACCCAG
TGTCCTGGGCAGACATGATTGCTGTGGCTGGAGCAGAAGCAGTTTCAATATGTGGAGGTCCTACAATCCAAGTTCCGTTAGGCAGAC
TAGATTCAAA
GGAGCCTGATCCCGAAGGAAAACTTCCTGAAGAAACTCTGGATGCTTCTGGTCTGAAGCAAAGCTTCCAAACAAAAGGCTTCTCAACTCAGGAACTTGTTGCTCTGTCAG
GAGCCCATACTATTGGAAATAAAGGTTTCGGGAACCCAACGGTTTTTGACAATACATACTTCAAAATTCTTCTTGAGAAACCATCTTCAG
GTAGCATGATTGGCCTTCCCTCAGACCGTG
CACTTGCCAAGGATGATGAATGCTTAAG
CTGGATCACAAAGTATGCCGCGGACCAGAATATGTTCTTCAACGATTTCAAGACGGCTTATCTCAAACTAGTGAATTCGGGAGCCAGGTGGA
AGAGCTTGTGA

Retrieve as FASTA