Entry information : GmPrx32 (Glyma10g36690.1) )
Entry ID 520
Creation 2005-11-09 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx32 (Glyma10g36690.1) )
Name (synonym) GmPrx32 (Glyma10g36690.1) )
Class Class III peroxidase    [Orthogroup: Prx241]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Floral meristems
Immature leaves
Leaves
Roots
Somatic embryos
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx32
start..stop
S start..stop
PvPrx14 551 0 2..352 1..350
LjPrx05 502 3e-180 26..343 24..349
GmPrx329 467 1e-166 17..343 9..337
LjPrx11 464 3e-165 16..352 11..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44798127..44798390 264 N° 2 44797495..44797680 186 N° 3 44795974..44796582 609  
complement(join(44795974..44796582,44797495..44797680,44798127..44798390))


exon

Literature and cross-references GmPrx32 (Glyma10g36690.1) )
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm10 (44798390..44795974)
Protein sequence: GmPrx32 (Glyma10g36690.1) )
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353
PWM (Da):   %s   37934.28  
PI (pH):   %s   7.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMAGVSGSSTTPLLCSLFFISSLLFASCTHASSQAPPPIVDGLSWDFYRTSCPMLEGIVSKHLQKVFKKDNGQAPALLRIFFHDCFVQGCDGSILLDGSPNEKDQPANIGIRPEALQTIENLRSLVHKQCGRVVSCADLVVLAARDAVSLSGGPIFPVPLGRKDGLTFSIDGTGNLPGPSSRTGQLLDRFAGRNFDATDVVALSGAHTFGRAHCATFFSRINQTDPPIDPTLNNNLIKTCPSSQSPNTAVLDVRTPNVFDNKYYVNLANRQGLFTSDQDLFGDARTKGIVNSFAENQKLFFEKFSNAVVKLSQLDVLTGKQGQIRAKCSVPNKKKVVTSVVEEEGVDLSAQM*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 12 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCTGGTGTTAGTGGCAGTAGCACTACTCCCTTATTGTGCTCTTTGTTCTTTATTTCTTCCTTACTTTTTGCTTCCTGCACCCATGCCTCCTCCCAGGCACCTCCTCCAATTGTG
GATGGACTTTCATGGGATTTCTATAGGACGAGCTGTCCCATGCTTGAAGGGATAGTGAGCAAGCATCTCCAGAAGGTGTTCAAGAAGGACAATGGTCAAGCTCCTGCCTTACTCAGGATC
TTCTTCCATGACTGCTTTGTTCAG
GTAATATATAATACATGCATGGTGATTGACAAATAATTTTATCCCTTAAATATGCATGTGCTCTGGAGTTCGATTACAAGGTTCATGTGTGCATGA
AAACACATATTTTAATAAATCAGATTAATTTTTTAAATAAATCTAAGTATACATGTGGAAGGAGTAGTCCTTGACTCTTGGCTAAACAATACCCTAATTCATCAAAAACAATATACTTAA
CTACTATCTTTAGTGGCAACTAATGTTGATGAAGTAATATAGTTGTCGGTCTCTCTTATTCTGATATCCTAAATGGTTTGACAAAGATTTATCATGTGATCTTTATAACTGTGGTGGTGT
ACCATGAGTCGTGTTAAAAATGTACTTATTTTCATAAAAATATATTCATAGATATAAACAGTTCTTTTAAGGAGTATAAATAATGTTTATTTTAATGTTGATAAATAAAGGGTTGCGATG
GGTCGATATTGTTGGATGGAAGTCCAAATGAAAAGGATCAACCGGCAAACATAGGGATAAGGCCAGAGGCTTTGCAGACCATTGAAAATCTTCGATCTCTTGTTCACAAGCAGTGTGGAA
GGGTCGTCTCTTGCGCTGACCTCGTTGTTCTAGCCGCACGCGATGCTGTTTCTCTG
GTAATTTATTTCATCCATGCATCCTCTCTTATATTCAGATTCTCTACAAGAATATCAATCAGTT
AATTTGTGCCCTTCCTTTCTTTTCATCTCAAAAGTAAATAGTCAGAAAAATCATATCAAACCTATGTGCATGTTTGGTATTCGATCAGTAAACCTTGTTATGCACGAATCTTGAGATTAA
ATCAATGATATATAAAACGCATCTTACAAAAAAAAAGAGTGGACTGTAGAGATTCATTTTGTTGTCCATTTGCAACCGAAATCCAAACATTTACTCTATATACTTGAAAAAAAAAAAACA
CATAGTTAACTCCTATAGTAATATAGAAAATGCAATTAGAACGAAGGTACGTTGGATGATTGATATTTTAAATAATTGTTTTTATTTATTTTTACTTATTTTTCATCACTTTTTCCGTAC
ATATTTTAAAATATTCTAAAAGAAACCCAATTTTTCCTCGTTTTAATTGTGGAAAAAAAAATCCCGTTTGACCAAGTCTTCTTCTAAAGGATAATTTTTGCCATACATCACTTTAAACAC
CTAAAAAGGGGTGGTAATTATCCTTTAGTAGTACCACTGTCACAACACTTTTTCTTTTTGATTGGTTGGCAAAAAAAAATCACAACACTTTAACAATAAAATATTATTCATATAAATCAT
CACTCTCCAAACTCCCCATATTTCTACGATCACCATGACTATACTTGAAATAAAGCCATGAATATTTAACACAAAGCAAGTATAGCAATTAAAAAATGAATAACTTTTTTCCCCATAAAT
ACACTTTACATGTATAATAAATTAAAAAAGTTGAACCAGTAGTATTTATTTAATGCAACACGCATTAGCCAATAGCCATTAGCATTGTCTTACTATGACTTGTTTTTTTCTTCTTTGACT
ATGAGTAGTCAGGGGGGCCAATATTTCCCGTGCCACTGGGAAGAAAAGATGGTCTAACTTTCAGCATAGACGGCACAGGAAACCTTCCGGGACCGTCTTCCCGAACCGGCCAGCTCCTCG
ACAGATTTGCCGGCAGAAACTTCGACGCCACCGACGTGGTCGCGCTCTCCGGCGCTCACACCTTCGGACGGGCCCACTGCGCCACATTCTTCAGCCGCATCAACCAGACGGACCCACCCA
TCGACCCTACCTTGAACAACAACCTCATCAAAACTTGTCCCTCTTCCCAGTCCCCCAACACGGCCGTGCTTGACGTGAGAACCCCCAACGTGTTCGACAACAAGTACTACGTTAACCTCG
CCAACCGACAGGGTCTGTTTACCTCGGACCAGGACCTGTTCGGTGATGCCCGGACTAAGGGAATAGTTAACTCCTTTGCTGAAAACCAGAAACTGTTCTTTGAAAAGTTTTCAAATGCTG
TTGTTAAGTTGAGTCAGTTGGATGTGTTGACCGGGAAACAAGGACAGATTCGCGCCAAATGCTCCGTCCCCAACAAGAAGAAGGTGGTCACCTCTGTGGTGGAAGAAGAGGGAGTGGATT
TAAGCGCTCAGATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCTGGTGTTAGTGGCAGTAGCACTACTCCCTTATTGTGCTCTTTGTTCTTTATTTCTTCCTTACTTTTTGCTTCCTGCACCCATGCCTCCTCCCAGGCACCTCCTCCAATTGTG
GATGGACTTTCATGGGATTTCTATAGGACGAGCTGTCCCATGCTTGAAGGGATAGTGAGCAAGCATCTCCAGAAGGTGTTCAAGAAGGACAATGGTCAAGCTCCTGCCTTACTCAGGATC
TTCTTCCATGACTGCTTTGTTCAG
GGTTGCGATGGGTCGATATTGTTGGATGGAAGTCCAAATGAAAAGGATCAACCGGCAAACATAGGGATAAGGCCAGAGGCTTTGCAGACCATTGAA
AATCTTCGATCTCTTGTTCACAAGCAGTGTGGAAGGGTCGTCTCTTGCGCTGACCTCGTTGTTCTAGCCGCACGCGATGCTGTTTCTCTG
TCAGGGGGGCCAATATTTCCCGTGCCACTG
GGAAGAAAAGATGGTCTAACTTTCAGCATAGACGGCACAGGAAACCTTCCGGGACCGTCTTCCCGAACCGGCCAGCTCCTCGACAGATTTGCCGGCAGAAACTTCGACGCCACCGACGTG
GTCGCGCTCTCCGGCGCTCACACCTTCGGACGGGCCCACTGCGCCACATTCTTCAGCCGCATCAACCAGACGGACCCACCCATCGACCCTACCTTGAACAACAACCTCATCAAAACTTGT
CCCTCTTCCCAGTCCCCCAACACGGCCGTGCTTGACGTGAGAACCCCCAACGTGTTCGACAACAAGTACTACGTTAACCTCGCCAACCGACAGGGTCTGTTTACCTCGGACCAGGACCTG
TTCGGTGATGCCCGGACTAAGGGAATAGTTAACTCCTTTGCTGAAAACCAGAAACTGTTCTTTGAAAAGTTTTCAAATGCTGTTGTTAAGTTGAGTCAGTTGGATGTGTTGACCGGGAAA
CAAGGACAGATTCGCGCCAAATGCTCCGTCCCCAACAAGAAGAAGGTGGTCACCTCTGTGGTGGAAGAAGAGGGAGTGGATTTAAGCGCTCAGATGTGA

Retrieve as FASTA