Entry information : AniKat01 (AniKatA / Catalase A)
Entry ID 5213
Creation 2010-02-08 (Christophe Dunand)
Last sequence changes 2010-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AniKat01 (AniKatA / Catalase A)
Name (synonym) AniKat01 (AniKatA / Catalase A)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Emericella
Organism Aspergillus nidulans-Emericella nidulans    [TaxId: 162425 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AniKat01
start..stop
S start..stop
NfKat01 1243 0 1..744 1..746
AfumKat01 1235 0 1..744 1..750
AorKat01 1228 0 1..744 1..747
AclKat01 1228 0 1..744 1..746
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3296349..3296895 547 N° 2 3296945..3298632 1688  
join(3296349..3296895,3296945..3298632)


exon

Literature and cross-references AniKat01 (AniKatA / Catalase A)
Literature Galagan J.E., Calvo S.E., Cuomo C., Ma L.-J., Wortman J.R., Batzoglou S., Lee S.-I., Bastuerkmen M., Spevak C.C., Clutterbuck J., Kapitonov V., Jurka J., Scazzocchio C., Farman M.L., Butler J., Purcell S., Harris S., Braus G.H., Draht O., Busch S., D'Enfert C., Bouchier C., Goldman G.H., Bell-Pedersen D., Griffiths-Jones S., Doonan J.H., Yu J., Vienken K., Pain A., Freitag M., Selker E.U., Archer D.B., Penalva M.A., Oakley B.R., Momany M., Tanaka T., Kumagai T., Asai K., Machida M., Nierman W.C., Denning D.W., Caddick M., Hynes M., Paoletti M., Fischer R., Miller B.L., Dyer P.S., Sachs M.S., Osmani S.A., Birren B.W.;
"Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae.";
Nature 438:1105-1115(2005).
Protein ref. UniProtKB:   Q5ASU3
DNA ref. JGI genome:   ChrIII_A_nidulans_FGSC_A4 (3296349..3298632)
Protein sequence: AniKat01 (AniKatA / Catalase A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   744
PWM (Da):   %s   83790.19  
PI (pH):   %s   6.46
Sequence 785
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSITAGLQKAQQAVQDTATKNKKIVDISHDTVNVHTDQEQRTDFGVAITDPDHWLRVTNETHSGPSLLEDHIARERIHRFDHERIPERVVHARGTGAYGNFTLKESIEDLTYAGVLTDTSRNTPVFVRFSTVQGSRGSADTVRDVRGFAVKFYTDEGNWDIVGNNIPVFFIQDAIKFPDFVHAVKPEPHNEVPQAQTAHNNFWDFVYLHPEATHMFMWAMSDRAIPRSYRMMQGFGVNTFSLVNKEGKRHFVKFHWIPHLGVHSLVWDEALKLAGQDPDFHRKDLMEAIDNKAYPKWDFAIQAIPEEDQDKFEFDIFDATKVWPEEQVPLRVVGELELNRNIDEFFPETEQVAFCTSHIVPGIDFSDDPLLQGRNFSYQDTQISRLGVNWEEIPINRPVCPFLNHNRDGAKRHRITKGTVNYWPNRFEANPPASDKGFKSHPAPITGRKRRDLTPKFKEYHNQAQLFYNSLSEVEKVHVKKAFSFELDHCDDPIVYERLAGQRLAEIDLPLAQAVAEMVGAPIPTKALRDNHGKTSVRLSQFDFTPKAPGIISRRIAIIIGDGYDKIAFNGMKAAILAAQALPFVIGTKRSAIYAQGEDKNSSKGVIPDHMYDGMRSTMFDATFIPGGSHIETLQKNGQIRYWIAETFGHLKALGAMGEAAQLVKEVLGNVMGVQIAGADSAEPVEWYGVVTARGPESAESLSEGFKVLKDAGDFTSKFFYQISQHRNWQRELDGLASTVAF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, 1 introns) and 2 ESTs (AI210456, AA783167). Strain="FGSC A26". Spore-specific catalase"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTACTAGTATCACCGCCGGCCTACAAAAGGCCCAGCAAGCAGTGCAGGACACTGCCACCAAGAACAAGAAGATTGTCGATATTAGCCACGACACAGTAAATGTCCACACAGACCAGG
AGCAGCGAACAGATTTTGGTGTCGCGATCACCGACCCTGATCACTGGCTGCGCGTCACCAACGAGACGCACTCGGGCCCCTCGCTGCTAGAAGACCACATCGCGCGAGAGCGCATCCATC
GTTTCGACCACGAGCGCATCCCTGAGCGCGTTGTTCATGCCCGTGGAACGGGCGCCTACGGCAATTTCACCCTCAAGGAGAGCATCGAAGATTTGACCTATGCTGGAGTGTTAACGGATA
CTTCGCGCAACACCCCGGTGTTCGTGCGTTTCTCTACTGTCCAGGGCAGCCGGGGGAGTGCTGATACCGTTCGCGATGTTCGCGGGTTCGCTGTCAAGTTCTACACTGACGAGGGAAATT
GGGATATTGTCGGCAACAACATCCCCGTCTTCTTCATTCAGGATGCCATCAAGTTCCCTGACTTTG
GTACGTGCCCCCCAAATGACCGCGACTGAGTGATGCTAACTGCCTGCAGTCCAC
GCTGTCAAGCCCGAGCCTCACAACGAAGTGCCCCAGGCCCAGACGGCCCATAACAATTTCTGGGACTTTGTGTACTTGCACCCCGAAGCCACGCACATGTTCATGTGGGCGATGTCTGAC
CGCGCCATCCCGCGGTCCTACCGTATGATGCAGGGTTTCGGTGTTAACACGTTCTCGCTGGTCAACAAGGAGGGTAAGCGCCACTTTGTCAAATTCCACTGGATCCCTCACCTCGGAGTG
CACTCGCTCGTCTGGGACGAGGCCCTGAAGCTGGCGGGACAGGATCCCGACTTCCACCGCAAGGACCTGATGGAGGCCATCGATAACAAGGCCTATCCCAAGTGGGACTTTGCCATCCAG
GCCATCCCCGAGGAGGACCAGGACAAGTTCGAGTTTGACATCTTCGATGCCACCAAGGTCTGGCCGGAAGAGCAGGTGCCCCTGCGTGTGGTCGGCGAGCTCGAACTGAACCGCAACATC
GACGAGTTCTTCCCCGAGACTGAACAGGTCGCCTTCTGCACTAGCCATATCGTGCCTGGTATCGACTTCTCTGACGACCCGCTTCTCCAGGGCCGCAACTTCTCATATCAGGATACACAA
ATTAGTCGTCTGGGTGTGAACTGGGAAGAAATACCCATCAACCGACCTGTCTGCCCGTTCCTCAACCATAACCGGGACGGAGCTAAACGCCACCGCATCACCAAGGGCACGGTGAACTAT
TGGCCCAACCGCTTCGAGGCCAACCCTCCAGCTAGCGACAAGGGCTTCAAGTCGCACCCAGCCCCGATTACAGGCCGCAAGCGCCGCGATCTCACACCCAAGTTCAAGGAATACCACAAC
CAGGCGCAGCTTTTCTATAACTCCCTCTCCGAAGTCGAGAAGGTGCACGTCAAGAAGGCCTTTTCCTTCGAGCTTGACCACTGTGACGACCCGATCGTTTACGAGCGGCTCGCAGGCCAG
CGCCTCGCAGAGATCGATCTCCCCCTGGCTCAAGCCGTGGCCGAGATGGTCGGCGCGCCCATCCCCACGAAGGCACTGCGTGATAACCACGGCAAGACCTCCGTCCGTCTCTCCCAGTTC
GACTTCACTCCTAAGGCTCCTGGCATTATCAGCCGTCGCATTGCCATCATCATCGGTGACGGCTACGACAAGATCGCCTTCAATGGCATGAAGGCCGCTATTCTCGCCGCGCAAGCGCTC
CCCTTCGTCATTGGCACCAAACGCTCCGCCATCTACGCACAGGGCGAGGATAAGAATAGCTCTAAGGGTGTGATTCCCGACCACATGTATGACGGCATGCGCTCCACCATGTTCGACGCG
ACCTTCATCCCCGGCGGCTCGCACATTGAGACTCTCCAAAAGAACGGCCAGATTCGGTACTGGATTGCCGAGACATTCGGGCACCTCAAGGCGCTCGGTGCCATGGGCGAAGCCGCGCAG
CTGGTCAAGGAAGTTCTGGGCAATGTGATGGGCGTCCAAATTGCCGGTGCGGACTCTGCTGAGCCCGTCGAATGGTATGGTGTTGTTACAGCTCGTGGACCAGAGAGCGCCGAGAGCCTC
AGTGAGGGCTTCAAGGTGCTCAAGGACGCCGGTGATTTCACAAGCAAGTTCTTTTACCAGATCAGTCAGCACCGCAACTGGCAGCGTGAGTTGGATGGATTGGCTTCGACGGTTGCGTTC
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTACTAGTATCACCGCCGGCCTACAAAAGGCCCAGCAAGCAGTGCAGGACACTGCCACCAAGAACAAGAAGATTGTCGATATTAGCCACGACACAGTAAATGTCCACACAGACCAGG
AGCAGCGAACAGATTTTGGTGTCGCGATCACCGACCCTGATCACTGGCTGCGCGTCACCAACGAGACGCACTCGGGCCCCTCGCTGCTAGAAGACCACATCGCGCGAGAGCGCATCCATC
GTTTCGACCACGAGCGCATCCCTGAGCGCGTTGTTCATGCCCGTGGAACGGGCGCCTACGGCAATTTCACCCTCAAGGAGAGCATCGAAGATTTGACCTATGCTGGAGTGTTAACGGATA
CTTCGCGCAACACCCCGGTGTTCGTGCGTTTCTCTACTGTCCAGGGCAGCCGGGGGAGTGCTGATACCGTTCGCGATGTTCGCGGGTTCGCTGTCAAGTTCTACACTGACGAGGGAAATT
GGGATATTGTCGGCAACAACATCCCCGTCTTCTTCATTCAGGATGCCATCAAGTTCCCTGACTTTG
TCCACGCTGTCAAGCCCGAGCCTCACAACGAAGTGCCCCAGGCCCAGACGGCCC
ATAACAATTTCTGGGACTTTGTGTACTTGCACCCCGAAGCCACGCACATGTTCATGTGGGCGATGTCTGACCGCGCCATCCCGCGGTCCTACCGTATGATGCAGGGTTTCGGTGTTAACA
CGTTCTCGCTGGTCAACAAGGAGGGTAAGCGCCACTTTGTCAAATTCCACTGGATCCCTCACCTCGGAGTGCACTCGCTCGTCTGGGACGAGGCCCTGAAGCTGGCGGGACAGGATCCCG
ACTTCCACCGCAAGGACCTGATGGAGGCCATCGATAACAAGGCCTATCCCAAGTGGGACTTTGCCATCCAGGCCATCCCCGAGGAGGACCAGGACAAGTTCGAGTTTGACATCTTCGATG
CCACCAAGGTCTGGCCGGAAGAGCAGGTGCCCCTGCGTGTGGTCGGCGAGCTCGAACTGAACCGCAACATCGACGAGTTCTTCCCCGAGACTGAACAGGTCGCCTTCTGCACTAGCCATA
TCGTGCCTGGTATCGACTTCTCTGACGACCCGCTTCTCCAGGGCCGCAACTTCTCATATCAGGATACACAAATTAGTCGTCTGGGTGTGAACTGGGAAGAAATACCCATCAACCGACCTG
TCTGCCCGTTCCTCAACCATAACCGGGACGGAGCTAAACGCCACCGCATCACCAAGGGCACGGTGAACTATTGGCCCAACCGCTTCGAGGCCAACCCTCCAGCTAGCGACAAGGGCTTCA
AGTCGCACCCAGCCCCGATTACAGGCCGCAAGCGCCGCGATCTCACACCCAAGTTCAAGGAATACCACAACCAGGCGCAGCTTTTCTATAACTCCCTCTCCGAAGTCGAGAAGGTGCACG
TCAAGAAGGCCTTTTCCTTCGAGCTTGACCACTGTGACGACCCGATCGTTTACGAGCGGCTCGCAGGCCAGCGCCTCGCAGAGATCGATCTCCCCCTGGCTCAAGCCGTGGCCGAGATGG
TCGGCGCGCCCATCCCCACGAAGGCACTGCGTGATAACCACGGCAAGACCTCCGTCCGTCTCTCCCAGTTCGACTTCACTCCTAAGGCTCCTGGCATTATCAGCCGTCGCATTGCCATCA
TCATCGGTGACGGCTACGACAAGATCGCCTTCAATGGCATGAAGGCCGCTATTCTCGCCGCGCAAGCGCTCCCCTTCGTCATTGGCACCAAACGCTCCGCCATCTACGCACAGGGCGAGG
ATAAGAATAGCTCTAAGGGTGTGATTCCCGACCACATGTATGACGGCATGCGCTCCACCATGTTCGACGCGACCTTCATCCCCGGCGGCTCGCACATTGAGACTCTCCAAAAGAACGGCC
AGATTCGGTACTGGATTGCCGAGACATTCGGGCACCTCAAGGCGCTCGGTGCCATGGGCGAAGCCGCGCAGCTGGTCAAGGAAGTTCTGGGCAATGTGATGGGCGTCCAAATTGCCGGTG
CGGACTCTGCTGAGCCCGTCGAATGGTATGGTGTTGTTACAGCTCGTGGACCAGAGAGCGCCGAGAGCCTCAGTGAGGGCTTCAAGGTGCTCAAGGACGCCGGTGATTTCACAAGCAAGT
TCTTTTACCAGATCAGTCAGCACCGCAACTGGCAGCGTGAGTTGGATGGATTGGCTTCGACGGTTGCGTTCTAA

Retrieve as FASTA