Entry information : PoKat02_Florida (pcat2)
Entry ID 5218
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2012-04-06 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-05 (Achraf Jemmat)
Peroxidase information: PoKat02_Florida (pcat2)
Name (synonym) PoKat02_Florida (pcat2)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoKat02_Florida
start..stop
S start..stop
PplKat03 1060 0 2..740 3..743
PcKat05 1055 0 3..740 2..739
PcKat04 1054 0 3..740 2..740
PcarKat05 1041 0 3..740 2..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 296561..296712 152 N° 2 296779..297022 244 N° 3 297079..297295 217 N° 4 297349..297549 201
N° 5 297601..297941 341 N° 6 297995..298143 149 N° 7 298198..298856 659 N° 8 298921..299180 260
join(296561..296712,296779..297022,297079..297295,297349..297549,297601..297941, 297995..298143,298198..298856,298921..299180)


exon

Literature and cross-references PoKat02_Florida (pcat2)
Literature Goldberg D. et al., Submitted (MAR-1999) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB:   O94154
DNA ref. GenBank:   U75451.2 JGI genome:   scaffold_04 (296561..299180)
Protein sequence: PoKat02_Florida (pcat2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   82180.26  
PI (pH):   %s   6.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSVTAAAKQAVSSITDNAKMASLTQFRVECGPSQRMTTDQGLHVADTDNCNSNVGPALLEDHIAREKIMRFDHERIPERVVHARGAGAHGYFKAYDSSAEQWTKAKVLMDPSRTTPVFVRFSTVQGSRGSDTVRDVRGFAVKFYTEEGNWDIVGNNIPVFFIQDAIKFPDIIHAVKPEPHNEVPTGQSAHNNFWDFVGLQPESAHMIMWVMSDRAIPRSYRMMQGFGVNTYTLLNATGEKHFVKFHWIPELGVHSLVWDEALKIAGQDPDFHRKDLNEAIESGAYPKWRLALQVISEKDEHNFDFDILDATKIWPEELVPLHFVGEMVLNKVVDEYFAEVEQVAFCTSNIVPGIGFSDDPLLQGRNFSYLDTQLSRLGINWQIPINRPVCPVMNFQRDGQMQMKIHKGTVNYWPNRQEAVQPVAVSEGGYDDHVRKISGIAQRMRGPKFNEHYSQAQLFYNSLSPTEQTHLQSALAFELSHCEDPAVYRNYINILNNIDYQLAKYVAVAVGGDVPDASAKPNEGNKSARLSQVYYAPKEPTIKGRRIAILLADGFDKAEVVAIKALITSASANAFVIGPRRGKVYAAGEKIGVEGGGIDADHHFEGQRSTMFDALVIPSGEHVALLMKSGRAVHWLREAFGHCKAIGAVGAILLVQQAINLPEVQYADPTDSSIEVIVSYSVVTTAHYGVSTAIGDATKMTLSIGEKGFMERFAYEVSKHRCFKREEDGLTARIAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). Strain="florida / F6"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCGTCACAGCAGCAGCAAAGCAGGCGGTATCGAGTATCACCGACAATGCGAAAATGGCTAGTTTGACTCAATTCCGCGTCGAGTGTGGTCCTTCGCAGCGGATGACCACCGAC
CAGGGACTTCATGTAGCCGACACAGACAACTG
GTGAGGAATGCGTTATCTGTAGATATCAACAGTGCTGACCATGTCTGTCAGGCTCAAGGTCGGCAGTAACTCAAATGTAGGACCAGCA
TTGCTTGAAGATCACATCGCACGAGAGAAGATTATGCGCTTTGACCACGAGCGCATCCCAGAACGAGTGGTACACGCACGAGGGGCTGGTGCGCATGGCTATTTCAAAGCGTATGATTCG
AGTGCAGAGCAGTGGACGAAGGCCAAAGTCCTCATGGATCCGTCACGTACGACACCGGTATTCGTGCGGTTTAGCACGGTGCAAGGCTCCAGAGGAAGTGCT
GTAAGCGAATCGGCTTGA
TTCGCACTCGCGATGTTTCATGCTGATCACGATGACAGGACACTGTTCGCGACGTCAGGGGCTTTGCGGTGAAATTCTACACCGAAGAGGGGAATTGGGACATCGTGGGGAACAATATCC
CGGTGTTCTTCATCCAGGATGCGATCAAGTTCCCTGATATCATCCATGCGGTCAAGCCTGAGCCTCACAACGAAGTACCTACAGGGCAGAGCGCGCACAACAACTTCTGGGACTTTGTTG
GGCTTCAACCAGAGT
GTAAGTGCGACCCTGTGTTAACTCGGAATTCCGACTGACGACCATTCCGACAGCGGCGCATATGATCATGTGGGTGATGTCTGACCGCGCGATCCCTCGTTCGTA
CCGGATGATGCAGGGTTTTGGCGTGAACACGTACACGCTCTTAAACGCTACGGGCGAGAAGCACTTTGTGAAGTTTCATTGGATCCCAGAGCTCGGTGTCCACAGCCTAGTCTGGGATGA
AGCTCTTAAAATCGCGGGTCAAGATCCTG
GTAATGCATAATCACCATACACACAGCGTGTACGCTCACCTTAGTTCGCAGATTTCCATCGCAAAGATTTGAATGAAGCCATCGAGTCCGG
GGCCTATCCTAAATGGCGTCTAGCACTCCAAGTCATCTCTGAGAAGGACGAACACAACTTCGACTTCGATATCCTCGACGCGACGAAGATATGGCCCGAGGAGTTGGTGCCACTGCATTT
TGTGGGCGAGATGGTTCTGAACAAGGTGGTTGATGAGTATTTTGCCGAGGTGGAGCAGGTTGCTTTTTGTACCAGCAACATTGTACCAGGAATCGGGTTCAGCGACGACCCGCTGCTCCA
AGGCAGGAACTTTAGTTACCTCGACACGCAGCTTAGCCGTCTAGGTATCAACTGGCAACAG
GTAGGTTCCCTCCACTTTGAGTGTCTCCGGGCGGGCAATGACCATCGCTTCAGATTCCC
ATTAACCGACCTGTCTGCCCTGTGATGAATTTCCAGCGCGATGGGCAAATGCAGATGAAGATCCACAAGGGCACCGTCAACTATTGGCCCAACCGCCAGGAAGCCGTTCAGCCCGTCGCT
GTTTCGGAAGGCGGCTACGATGA
GTGAGTGTTGATCTGAACTGTCCAGCTCGCCTCTAAAGCGTTTCGGTCGGATAGTCATGTTCGCAAGATCTCCGGAATAGCCCAACGCATGCGTGGA
CCAAAATTCAACGAGCACTACTCTCAGGCCCAGCTCTTCTACAACTCCCTCTCGCCTACGGAGCAAACACACCTGCAGAGCGCGCTTGCCTTCGAGCTCAGCCACTGCGAGGACCCGGCC
GTGTACCGCAACTACATTAACATCCTCAACAACATCGACTATCAGCTCGCGAAGTATGTCGCCGTCGCCGTGGGAGGCGACGTCCCCGATGCGTCAGCGAAGCCCAACGAGGGGAACAAA
AGCGCTAGGCTGAGCCAGGTGTACTATGCGCCGAAGGAGCCGACTATCAAAGGCCGGCGCATCGCCATTCTGCTGGCGGATGGGTTCGATAAGGCGGAGGTTGTGGCTATCAAGGCACTC
ATTACGTCGGCGTCGGCGAATGCGTTCGTTATTGGGCCGAGGAGGGGCAAGGTCTACGCTGCTGGCGAGAAGATTGGTGTCGAGGGAGGCGGGATTGATGCGGATCATCACTTTGAAGGG
CAGCGTAGCACAATGTTCGATGCGCTCGTCATTCCGAGCGGGGAGCATGTTGCGTTGTTGATGAAGAGTGGGCGCGCTGTGCATTGGTTGAGAGAGGCGTTCGGGCATTGCAAGGCGATC
GGTGCCGTCGGGGAAG
GTAAGTGCACGCCACACATCATTTAAGATTGTTGGTGCTTATCGAAATTATATATACATAACAGCTATACTCCTCGTGCAGCAGGCCATCAACCTGCCAGAAGT
CCAATACGCAGACCCCACCGATAGTTCTATAGAAGTTATAGTGTCGTACAGCGTAGTGACAACGGCCCACTATGGCGTGTCGACGGCTATTGGAGACGCTACGAAGATGACGCTGAGCAT
TGGTGAGAAGGGGTTCATGGAAAGGTTTGCGTACGAGGTCAGCAAGCACCGGTGCTTCAAGAGGGAGGAGGACGGGTTGACTGCGAGGATTGCGTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCGTCACAGCAGCAGCAAAGCAGGCGGTATCGAGTATCACCGACAATGCGAAAATGGCTAGTTTGACTCAATTCCGCGTCGAGTGTGGTCCTTCGCAGCGGATGACCACCGAC
CAGGGACTTCATGTAGCCGACACAGACAACTG
TAACTCAAATGTAGGACCAGCATTGCTTGAAGATCACATCGCACGAGAGAAGATTATGCGCTTTGACCACGAGCGCATCCCAGAACGA
GTGGTACACGCACGAGGGGCTGGTGCGCATGGCTATTTCAAAGCGTATGATTCGAGTGCAGAGCAGTGGACGAAGGCCAAAGTCCTCATGGATCCGTCACGTACGACACCGGTATTCGTG
CGGTTTAGCACGGTGCAAGGCTCCAGAGGAAGTGCT
GACACTGTTCGCGACGTCAGGGGCTTTGCGGTGAAATTCTACACCGAAGAGGGGAATTGGGACATCGTGGGGAACAATATCCCG
GTGTTCTTCATCCAGGATGCGATCAAGTTCCCTGATATCATCCATGCGGTCAAGCCTGAGCCTCACAACGAAGTACCTACAGGGCAGAGCGCGCACAACAACTTCTGGGACTTTGTTGGG
CTTCAACCAGAGT
CGGCGCATATGATCATGTGGGTGATGTCTGACCGCGCGATCCCTCGTTCGTACCGGATGATGCAGGGTTTTGGCGTGAACACGTACACGCTCTTAAACGCTACGGGC
GAGAAGCACTTTGTGAAGTTTCATTGGATCCCAGAGCTCGGTGTCCACAGCCTAGTCTGGGATGAAGCTCTTAAAATCGCGGGTCAAGATCCTG
ATTTCCATCGCAAAGATTTGAATGAA
GCCATCGAGTCCGGGGCCTATCCTAAATGGCGTCTAGCACTCCAAGTCATCTCTGAGAAGGACGAACACAACTTCGACTTCGATATCCTCGACGCGACGAAGATATGGCCCGAGGAGTTG
GTGCCACTGCATTTTGTGGGCGAGATGGTTCTGAACAAGGTGGTTGATGAGTATTTTGCCGAGGTGGAGCAGGTTGCTTTTTGTACCAGCAACATTGTACCAGGAATCGGGTTCAGCGAC
GACCCGCTGCTCCAAGGCAGGAACTTTAGTTACCTCGACACGCAGCTTAGCCGTCTAGGTATCAACTGGCAACAG
ATTCCCATTAACCGACCTGTCTGCCCTGTGATGAATTTCCAGCGC
GATGGGCAAATGCAGATGAAGATCCACAAGGGCACCGTCAACTATTGGCCCAACCGCCAGGAAGCCGTTCAGCCCGTCGCTGTTTCGGAAGGCGGCTACGATGA
TCATGTTCGCAAGATC
TCCGGAATAGCCCAACGCATGCGTGGACCAAAATTCAACGAGCACTACTCTCAGGCCCAGCTCTTCTACAACTCCCTCTCGCCTACGGAGCAAACACACCTGCAGAGCGCGCTTGCCTTC
GAGCTCAGCCACTGCGAGGACCCGGCCGTGTACCGCAACTACATTAACATCCTCAACAACATCGACTATCAGCTCGCGAAGTATGTCGCCGTCGCCGTGGGAGGCGACGTCCCCGATGCG
TCAGCGAAGCCCAACGAGGGGAACAAAAGCGCTAGGCTGAGCCAGGTGTACTATGCGCCGAAGGAGCCGACTATCAAAGGCCGGCGCATCGCCATTCTGCTGGCGGATGGGTTCGATAAG
GCGGAGGTTGTGGCTATCAAGGCACTCATTACGTCGGCGTCGGCGAATGCGTTCGTTATTGGGCCGAGGAGGGGCAAGGTCTACGCTGCTGGCGAGAAGATTGGTGTCGAGGGAGGCGGG
ATTGATGCGGATCATCACTTTGAAGGGCAGCGTAGCACAATGTTCGATGCGCTCGTCATTCCGAGCGGGGAGCATGTTGCGTTGTTGATGAAGAGTGGGCGCGCTGTGCATTGGTTGAGA
GAGGCGTTCGGGCATTGCAAGGCGATCGGTGCCGTCGGGGAAG
CTATACTCCTCGTGCAGCAGGCCATCAACCTGCCAGAAGTCCAATACGCAGACCCCACCGATAGTTCTATAGAAGTT
ATAGTGTCGTACAGCGTAGTGACAACGGCCCACTATGGCGTGTCGACGGCTATTGGAGACGCTACGAAGATGACGCTGAGCATTGGTGAGAAGGGGTTCATGGAAAGGTTTGCGTACGAG
GTCAGCAAGCACCGGTGCTTCAAGAGGGAGGAGGACGGGTTGACTGCGAGGATTGCGTATTGA

Retrieve as FASTA