Entry information : CnKat01_grubiiH99 (Catalase 1 / CAT1)
Entry ID 5220
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2007-04-16 (Marcel Zamocky)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-23 (Catherine Mathe (Scipio))
Peroxidase information: CnKat01_grubiiH99 (Catalase 1 / CAT1)
Name (synonym) CnKat01_grubiiH99 (Catalase 1 / CAT1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat01_grubiiH99
start..stop
S start..stop
CnKat01_JEC21 1421 0 1..714 1..714
CnKat01_B-3501A 1421 0 1..714 1..714
CnKat03_H99 1292 0 1..714 1..714
CnKat03_JEC21 1281 0 1..714 1..714
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 139201..139222 22 N° 2 139277..139435 159 N° 3 139488..139621 134 N° 4 139669..139810 142
N° 5 139865..139896 32 N° 6 139949..140395 447 N° 7 140451..140867 417 N° 8 140921..141295 375
N° 9 141358..141774 417  
join(139201..139222,139277..139435,139488..139621,139669..139810,139865..139896, 139949..140395,140451..140867,140921..141295,141358..141774)


exon

Literature and cross-references CnKat01_grubiiH99 (Catalase 1 / CAT1)
Literature Giles S.S., Stajich J.E., Nichols C., Gerrald Q.D., Alspaugh J.A., Dietrich F., Perfect J.R. The Cryptococcus neoformans catalase gene family and its role in antioxidant defense. Eukaryot. Cell 5:1447-1459(2006).
Protein ref. UniProtKB:   Q15EU7
DNA ref. JGI genome:   cneoH99_Chr4 (139201..141774)
Protein sequence: CnKat01_grubiiH99 (Catalase 1 / CAT1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   714
PWM (Da):   %s   80042.35  
PI (pH):   %s   6.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQMLNQAVNAVTGDAKYRQMAENTIEQTKSTPLTTYFGVKVPETDVALRAGARGPTLLEDFHNREKIQHFDHERIPERVVHARGSAAHGEFKLHTPLTGITTAVLTDTSKVVPAYVRFSTVAGSRGSADTVRDVRGFATRFYTDEGNWDLVGNNIPVFFIDAIKFPDVIHALKPQPHNEIPQAQTAHDNAWDFISLHQQATHMQQWVTSDRAIPRSYRMMQGFGVHTFRLINEEGKSTFVKYHWIPHLGIHSLVWDEALKVAGQDPDFHRRDLWDAIEVGAYPKWELGVQLIPEEDEHKFDFDILDSTKIIPEELVPVQKIGTLTLNRNPVDFFTEVEQVAFCTQHIVPGMDFTDDPLLAGRNFSYADTQISRLGVNWQDLPINRPICPVMTNFRDGQMSMFSKTNRTPYHPNRHENLPLTSPKNGGFQSYPEKISGIKERLNGPKFNEFYSQATLFWNSMSETEKNHIISAYQFELSHCAEDVVIQNVIISLNEIDHGLATSVHASFPHLTLPEAKPTHDRKSEYLSQINGKHQVFTASGRRIGIYLVPGYTYSQVVPLFAAFEAAGCMVKFIGPTLGPIKASNGQSFTAEFTFEGCRTTFFDAIVFAGGPDDSFVAKLKIGRLIHAVREAYMHLKPIGVLGNATQWVVNTCLPGDFSDKTKTESNVVVENGVVFAPGDPTIHSVQFAKQFLEGVANHRVWDRQVAHIAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). Strain="H99", variety="grubii", serotype="A".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCAAATGCTGAACCAAGGTAAGCAGAATCGATGCATTTTCAGCACAGCAAACCCTGATCTGATCTCGTTAGCCGTTAATGCCGTTACCGGCGATGCCAAATATCGCCAAATGGCA
GAAAATACCATCGAGCAGACCAAAAGCACCCCATTGACGACTTACTTTGGAGTGAAAGTCCCGGAAACTGATGTTGCGTTGCGAGCTGGTGCCAGGGGACCCACTCTGCTTGAAG
GTAAG
ATATGGTTTTCCTGCATTGATACCAAATCTAACATGACAACATATAGACTTCCATAATCGAGAGAAGATCCAACATTTTGACCATGAACGCATTCCCGAGCGAGTTGTGCACGCTCGTGG
CTCTGCAGCTCATGGAGAGTTCAAACTGCATACTCCTCTGACCGGCATCACTACTGCAAAG
GTAAACCAAAGAGCGAAATGCAGAATGTTAACTGATCGTGTATTTAGGTTTTGACCGAT
ACCAGCAAGGTTGTCCCTGCATATGTCAGGTTCAGCACGGTCGCTGGTTCACGAGGCAGCGCTGACACCGTGAGAGATGTCCGTGGCTTTGCCACTAGGTTCTATACCGACGAAGGTAAC
TGGGATCTCG
GTAAGTATTGGCATATCCTTGGGATGAACGATCATGCTGATCCACTTTTAACAGTGGGCAACAACATTCCAGTCTTCTTTATCCAAGTAAGTGTTTTGTACGGATTGCAT
AGGAATATATTTACTTACTTCTTCTCAGGATGCTATCAAATTCCCTGATGTTATTCACGCCCTTAAGCCCCAACCTCACAATGAGATACCTCAAGCCCAAACTGCGCATGACAACGCTTG
GGACTTTATTTCTCTTCATCAGCAAGCTACTCACATGCAGCAGTGGGTCACTTCCGACAGGGCTATTCCTCGATCCTATCGTATGATGCAAGGTTTCGGTGTTCATACATTCCGACTCAT
CAACGAGGAAGGCAAGAGCACATTTGTCAAGTACCACTGGATTCCTCATCTCGGCATTCATTCTCTTGTGTGGGATGAGGCTCTCAAGGTTGCCGGACAGGACCCGGACTTCCATCGAAG
GGATCTCTGGGACGCAATCGAAGTCGGGGCATACCCCAAGTGGGAATTGGGCGTACAACTGATCCCAGAGGAAGATGAACACAAGTTTGACTTCGATATCCTTGACTCAACCAAG
GTCAG
TTTTAGTAGGATGGGCAGCTCTCAATCGCGCTTGCTGATTCTTTATTTAGATCATCCCTGAGGAACTTGTACCTGTTCAAAAGATTGGGACTTTGACACTCAATCGCAACCCTGTCGATT
TCTTTACTGAAGTAGAGCAAGTTGCGTTTTGTACACAGCACATCGTCCCAGGAATGGATTTTACCGACGACCCTCTTCTTGCTGGCAGGAACTTCTCCTATGCTGACACTCAAATTTCAC
GTTTGGGCGTCAACTGGCAAGACCTCCCCATTAATAGACCTATCTGCCCCGTCATGACGAACTTCCGTGACGGGCAGATGAGCATGTTCAGCAAGACCAACAGGACGCCCTATCACCCCA
ACAGGCATGAGAACCTTCCACTCACGTCGCCCAAGAATGGTGGCTTCCAAAGCTATCCTGAGAAGATATCCGGTATTAAAGAGAGGCTCAATGGGCCTAAGTTTAAT
GTGAGCTTATCTT
AATTGCGCCAATGATCCAATGGCTTAATTAATGTTTCTAGGAATTCTATTCGCAAGCAACCCTTTTCTGGAACTCAATGTCCGAGACGGAGAAGAACCATATCATCAGCGCGTACCAATT
CGAGTTGTCGCACTGCGCAGAAGATGTTGTCATCCAAAACGTCATCATTAGTCTCAATGAGATCGACCACGGGCTTGCTACCTCGGTCCACGCCAGCTTCCCTCACCTTACTTTGCCTGA
GGCCAAACCCACCCACGACAGGAAGTCTGAGTACCTGTCGCAAATCAATGGCAAGCACCAAGTCTTCACCGCTTCTGGGCGAAGGATCGGCATTTACCTCGTGCCCGGGTACACCTACTC
GCAAGTTGTACCTTTGTTTGCTGCATTTGAAGCGGCTGGATGTATGGTGAAGTTT
GTGAGTTGCATCGTCAAAATATCTATAACGAGGGATAGACTGACAGATCGCGTGTCGTACAGATT
GGCCCTACGCTTGGTCCAATCAAGGCGTCAAATGGTCAGTCATTCACTGCCGAATTCACATTCGAGGGCTGTCGCACTACCTTCTTTGACGCTATTGTCTTCGCCGGTGGTCCCGATGAT
TCCTTCGTCGCGAAGCTCAAGATTGGCCGACTTATTCACGCGGTAAGGGAGGCCTATATGCACCTTAAACCTATTGGCGTACTTGGCAATGCTACCCAATGGGTGGTAAATACTTGCTTG
CCTGGAGATTTCAGCGACAAGACCAAGACTGAGTCAAATGTCGTCGTGGAAAACGGTGTTGTCTTCGCTCCCGGTGACCCAACAATCCACTCCGTTCAGTTTGCTAAGCAATTCCTGGAG
GGGGTCGCCAACCACCGTGTCTGGGACAGGCAAGTTGCGCACATTGCTGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCAAATGCTGAACCAAGCCGTTAATGCCGTTACCGGCGATGCCAAATATCGCCAAATGGCAGAAAATACCATCGAGCAGACCAAAAGCACCCCATTGACGACTTACTTTGGAGTG
AAAGTCCCGGAAACTGATGTTGCGTTGCGAGCTGGTGCCAGGGGACCCACTCTGCTTGAAG
ACTTCCATAATCGAGAGAAGATCCAACATTTTGACCATGAACGCATTCCCGAGCGAGTT
GTGCACGCTCGTGGCTCTGCAGCTCATGGAGAGTTCAAACTGCATACTCCTCTGACCGGCATCACTACTGCAAAG
GTTTTGACCGATACCAGCAAGGTTGTCCCTGCATATGTCAGGTTC
AGCACGGTCGCTGGTTCACGAGGCAGCGCTGACACCGTGAGAGATGTCCGTGGCTTTGCCACTAGGTTCTATACCGACGAAGGTAACTGGGATCTCG
TGGGCAACAACATTCCAGTCTTC
TTTATCCAA
GATGCTATCAAATTCCCTGATGTTATTCACGCCCTTAAGCCCCAACCTCACAATGAGATACCTCAAGCCCAAACTGCGCATGACAACGCTTGGGACTTTATTTCTCTTCAT
CAGCAAGCTACTCACATGCAGCAGTGGGTCACTTCCGACAGGGCTATTCCTCGATCCTATCGTATGATGCAAGGTTTCGGTGTTCATACATTCCGACTCATCAACGAGGAAGGCAAGAGC
ACATTTGTCAAGTACCACTGGATTCCTCATCTCGGCATTCATTCTCTTGTGTGGGATGAGGCTCTCAAGGTTGCCGGACAGGACCCGGACTTCCATCGAAGGGATCTCTGGGACGCAATC
GAAGTCGGGGCATACCCCAAGTGGGAATTGGGCGTACAACTGATCCCAGAGGAAGATGAACACAAGTTTGACTTCGATATCCTTGACTCAACCAAG
ATCATCCCTGAGGAACTTGTACCT
GTTCAAAAGATTGGGACTTTGACACTCAATCGCAACCCTGTCGATTTCTTTACTGAAGTAGAGCAAGTTGCGTTTTGTACACAGCACATCGTCCCAGGAATGGATTTTACCGACGACCCT
CTTCTTGCTGGCAGGAACTTCTCCTATGCTGACACTCAAATTTCACGTTTGGGCGTCAACTGGCAAGACCTCCCCATTAATAGACCTATCTGCCCCGTCATGACGAACTTCCGTGACGGG
CAGATGAGCATGTTCAGCAAGACCAACAGGACGCCCTATCACCCCAACAGGCATGAGAACCTTCCACTCACGTCGCCCAAGAATGGTGGCTTCCAAAGCTATCCTGAGAAGATATCCGGT
ATTAAAGAGAGGCTCAATGGGCCTAAGTTTAAT
GAATTCTATTCGCAAGCAACCCTTTTCTGGAACTCAATGTCCGAGACGGAGAAGAACCATATCATCAGCGCGTACCAATTCGAGTTG
TCGCACTGCGCAGAAGATGTTGTCATCCAAAACGTCATCATTAGTCTCAATGAGATCGACCACGGGCTTGCTACCTCGGTCCACGCCAGCTTCCCTCACCTTACTTTGCCTGAGGCCAAA
CCCACCCACGACAGGAAGTCTGAGTACCTGTCGCAAATCAATGGCAAGCACCAAGTCTTCACCGCTTCTGGGCGAAGGATCGGCATTTACCTCGTGCCCGGGTACACCTACTCGCAAGTT
GTACCTTTGTTTGCTGCATTTGAAGCGGCTGGATGTATGGTGAAGTTT
ATTGGCCCTACGCTTGGTCCAATCAAGGCGTCAAATGGTCAGTCATTCACTGCCGAATTCACATTCGAGGGC
TGTCGCACTACCTTCTTTGACGCTATTGTCTTCGCCGGTGGTCCCGATGATTCCTTCGTCGCGAAGCTCAAGATTGGCCGACTTATTCACGCGGTAAGGGAGGCCTATATGCACCTTAAA
CCTATTGGCGTACTTGGCAATGCTACCCAATGGGTGGTAAATACTTGCTTGCCTGGAGATTTCAGCGACAAGACCAAGACTGAGTCAAATGTCGTCGTGGAAAACGGTGTTGTCTTCGCT
CCCGGTGACCCAACAATCCACTCCGTTCAGTTTGCTAAGCAATTCCTGGAGGGGGTCGCCAACCACCGTGTCTGGGACAGGCAAGTTGCGCACATTGCTGCGTAG

Retrieve as FASTA