Entry information : CnKat01_JEC21 (CnKatA / Catalase A)
Entry ID 5221
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2007-04-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: CnKat01_JEC21 (CnKatA / Catalase A)
Name (synonym) CnKat01_JEC21 (CnKatA / Catalase A)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat01_JEC21
start..stop
S start..stop
CnKat01_B-3501A 1491 0 1..714 1..714
CnKat01_grubiiH99 1421 0 1..714 1..714
CnKat03_H99 1270 0 1..714 1..714
CnKat03_JEC21 1265 0 1..714 1..714
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 754677..754698 22 N° 2 754470..754628 159 N° 3 754283..754416 134 N° 4 754095..754236 142
N° 5 754009..754040 32 N° 6 753512..753958 447 N° 7 753042..753458 417 N° 8 752612..752986 375
N° 9 752133..752549 417  
complement(join(752133..752549,752612..752986,753042..753458,753512..753958,7540 09..754040,754095..754236,754283..754416,754470..754628,754677..754698))


exon

Literature and cross-references CnKat01_JEC21 (CnKatA / Catalase A)
Literature Loftus B.J., et al., The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans. Science 307:1321-1324(2005).
Protein ref. UniProtKB:   Q5K8B0
DNA ref. JGI genome:   NC_006681 (754698..752133)
Cluster/Prediction ref. UniGene:   Fne.3234
Protein sequence: CnKat01_JEC21 (CnKatA / Catalase A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   714
PWM (Da):   %s   80219.41  
PI (pH):   %s   6.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQMLNQAVTAVTGDAKYRQMAENTIEQTSKTPLTTYFGVKVPETDVALRAGARGPTLLEDFHNREKIQHFDHERIPERVVHARGSAAHGEFKLHTPLTGITTAVLTDTSKVVPAYVRFSTVVGSRGSADTVRDVRGFATRFYTDEGNWDLVGNNIPVFFIDAIKFPDVIHALKPEPHNEMPQAQTAHDNAWDFISLHQQATHMQQWVTSDRAIPRSYRMMQGFGVHTFRLINEEGKSTFVKYHWIPHLGIHSLVWDEALKIAGQDPDFHRRDLWDAIEAKAYPKWELGVQLIKEEDEHKFDFDILDSTKIIPEELVPVQKIGTLTLTRNPVDFFAEVEQVAFCTQHIVPGMDFTDDPLLAGRNFSYADTQISRLGTNWHDLPINRPICPVMTNFRDGQMSMFSKTNRTPYHPNRHDSLPLTSSNNGGFQSYREKISGVKERLNGPKFQEFYSQATLFWNSMSETEREHIIAAYNFELSHCAEDIVIQNVINSLNEIDHGLATSVHATFPHLTLPEAKPTHNKKSEYLSQINGKHQVFTASGRRIGIYLVPGYTYSQVVPLLAAFEADGCMVKFIGPTLGPIKASNGQSFTAEFTFEGCRTTFFDAIVFVGGPDDSFIAKLKIGRLIHAAREAYMHLKPIGVLGNATQWMVNTCLPGDFSEKTKTESSVVVENGVVFAPGDPTLHSIKFAKQFLEGVAHHRVWDRQVAHIAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 12, 8 introns) and 9 ESTs. Strain="JEC21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACAAATGCTGAATCAAGGTAAGCGGAATAGATGCATTTTAGCACAGCAAAGGCTGATCCCTTTAGCCGTTACTGCCGTTACTGGCGATGCTAAATATCGCCAAATGGCCGAGAAC
ACCATCGAACAGACCAGCAAGACTCCATTGACGACTTACTTTGGAGTGAAAGTCCCGGAAACTGATGTTGCGTTGCGAGCTGGTGCCAGGGGACCCACTCTCCTTGAAG
GTACGATATGG
TTTTCCTGCCAATGACCCCAAGCCTAACATGGCAACATATAGACTTCCATAACCGAGAGAAGATCCAACATTTTGATCATGAACGCATTCCCGAGCGAGTTGTGCACGCTCGTGGCTCTG
CAGCTCATGGAGAGTTCAAATTGCATACTCCTCTGACCGGCATCACTACTGCAAAG
GTAAACCAAAGAGCCGAGACGCAGAACGTTAGCTGATCGTAGACAGGTTTTGACCGATACCAGC
AAGGTCGTCCCTGCATATGTCAGGTTCAGCACGGTCGTTGGTTCACGAGGCAGCGCTGACACCGTGAGGGATGTCCGTGGCTTTGCCACTAGGTTTTATACCGACGAAGGTAACTGGGAT
CTCG
GTAAGTATTGGCTTGTTCTTGGGATGACTGCTCATGCTTATTCACTTTTAACAGTGGGCAACAACATCCCAGTCTTCTTCATCCAAGTAAGTCTTGTATGGATTGCGTAGGAGTAT
GTTTATTTACATCTTCTCAGGATGCTATCAAATTCCCTGATGTTATTCACGCCCTTAAGCCCGAGCCTCACAATGAGATGCCTCAAGCCCAAACTGCACACGATAACGCTTGGGACTTTA
TCTCTCTTCATCAGCAAGCTACTCACATGCAGCAGTGGGTCACCTCCGACAGGGCTATTCCTCGATCCTATCGTATGATGCAAGGTTTCGGTGTTCATACCTTCAGACTTATCAACGAGG
AAGGCAAGAGCACATTTGTCAAGTACCATTGGATTCCTCATCTCGGCATTCATTCTCTAGTGTGGGATGAGGCCCTCAAGATTGCCGGACAGGACCCGGACTTCCATCGAAGGGATCTCT
GGGACGCAATCGAAGCCAAAGCATACCCCAAGTGGGAATTGGGCGTACAACTGATCAAAGAGGAAGATGAACACAAGTTTGACTTCGACATTCTAGACTCAACCAAG
GTCAGTCATTAGG
CTGGGCAGCGCACAGTCGCACTTGCTGACCCCTCATTTAGATAATCCCTGAGGAACTCGTACCTGTTCAGAAGATTGGGACTTTGACGCTCACTCGCAACCCTGTCGATTTCTTTGCTGA
AGTAGAGCAAGTGGCCTTCTGTACACAACACATCGTTCCAGGCATGGACTTTACCGACGATCCTCTTCTTGCTGGCAGGAACTTCTCCTATGCTGACACTCAAATTTCACGTCTGGGCAC
CAACTGGCACGACCTCCCCATCAATAGACCTATTTGCCCCGTCATGACGAACTTCCGTGATGGGCAAATGAGTATGTTCAGCAAGACCAACAGGACACCCTACCACCCCAACAGGCACGA
TAGCCTTCCACTTACGTCTTCCAATAATGGTGGCTTCCAAAGCTATCGTGAGAAGATATCCGGTGTTAAAGAGCGGCTCAATGGGCCCAAGTTCCAG
GTGAGTTTATCTTGACTGCGCCA
ATGATGGAATGGCTAAGTAATGTTTCTTTTAGGAATTCTACTCGCAAGCAACCCTTTTCTGGAACTCAATGTCCGAGACGGAGAGGGAGCATATCATTGCCGCGTACAACTTCGAGTTGT
CACACTGCGCGGAAGACATTGTCATTCAAAACGTCATCAATAGCCTCAATGAAATCGACCACGGGCTTGCTACTTCGGTTCACGCTACCTTCCCTCACCTTACTTTGCCTGAGGCCAAAC
CCACCCACAATAAGAAGTCTGAATATCTGTCGCAAATCAATGGCAAGCACCAAGTCTTCACGGCTTCTGGGAGAAGGATTGGTATTTACCTCGTGCCCGGGTACACCTACTCGCAAGTTG
TACCTTTGCTTGCTGCTTTTGAAGCGGATGGATGTATGGTGAAATTT
GTGAGTTGCATCGTCAAACATCTATAACGAGGGGATAAACTGACGGATTGCGTGTCGTACAGATTGGCCCTAC
GCTTGGTCCAATCAAGGCTTCAAATGGTCAGTCATTCACCGCCGAATTCACGTTCGAAGGCTGTCGCACTACCTTCTTTGACGCTATTGTCTTCGTCGGCGGTCCCGATGATTCCTTCAT
CGCGAAGCTCAAGATTGGCCGACTTATTCATGCAGCAAGGGAGGCTTATATGCACCTTAAACCCATTGGCGTACTTGGCAATGCTACCCAATGGATGGTAAACACTTGCTTGCCTGGAGA
TTTCAGCGAGAAGACCAAGACTGAGTCAAGTGTCGTTGTGGAAAACGGTGTCGTCTTCGCCCCTGGTGACCCAACCCTCCATTCCATTAAGTTTGCTAAGCAATTCTTGGAGGGGGTCGC
CCACCACCGTGTCTGGGACAGGCAAGTTGCGCACATTGCTGCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACAAATGCTGAATCAAGCCGTTACTGCCGTTACTGGCGATGCTAAATATCGCCAAATGGCCGAGAACACCATCGAACAGACCAGCAAGACTCCATTGACGACTTACTTTGGAGTG
AAAGTCCCGGAAACTGATGTTGCGTTGCGAGCTGGTGCCAGGGGACCCACTCTCCTTGAAG
ACTTCCATAACCGAGAGAAGATCCAACATTTTGATCATGAACGCATTCCCGAGCGAGTT
GTGCACGCTCGTGGCTCTGCAGCTCATGGAGAGTTCAAATTGCATACTCCTCTGACCGGCATCACTACTGCAAAG
GTTTTGACCGATACCAGCAAGGTCGTCCCTGCATATGTCAGGTTC
AGCACGGTCGTTGGTTCACGAGGCAGCGCTGACACCGTGAGGGATGTCCGTGGCTTTGCCACTAGGTTTTATACCGACGAAGGTAACTGGGATCTCG
TGGGCAACAACATCCCAGTCTTC
TTCATCCAA
GATGCTATCAAATTCCCTGATGTTATTCACGCCCTTAAGCCCGAGCCTCACAATGAGATGCCTCAAGCCCAAACTGCACACGATAACGCTTGGGACTTTATCTCTCTTCAT
CAGCAAGCTACTCACATGCAGCAGTGGGTCACCTCCGACAGGGCTATTCCTCGATCCTATCGTATGATGCAAGGTTTCGGTGTTCATACCTTCAGACTTATCAACGAGGAAGGCAAGAGC
ACATTTGTCAAGTACCATTGGATTCCTCATCTCGGCATTCATTCTCTAGTGTGGGATGAGGCCCTCAAGATTGCCGGACAGGACCCGGACTTCCATCGAAGGGATCTCTGGGACGCAATC
GAAGCCAAAGCATACCCCAAGTGGGAATTGGGCGTACAACTGATCAAAGAGGAAGATGAACACAAGTTTGACTTCGACATTCTAGACTCAACCAAG
ATAATCCCTGAGGAACTCGTACCT
GTTCAGAAGATTGGGACTTTGACGCTCACTCGCAACCCTGTCGATTTCTTTGCTGAAGTAGAGCAAGTGGCCTTCTGTACACAACACATCGTTCCAGGCATGGACTTTACCGACGATCCT
CTTCTTGCTGGCAGGAACTTCTCCTATGCTGACACTCAAATTTCACGTCTGGGCACCAACTGGCACGACCTCCCCATCAATAGACCTATTTGCCCCGTCATGACGAACTTCCGTGATGGG
CAAATGAGTATGTTCAGCAAGACCAACAGGACACCCTACCACCCCAACAGGCACGATAGCCTTCCACTTACGTCTTCCAATAATGGTGGCTTCCAAAGCTATCGTGAGAAGATATCCGGT
GTTAAAGAGCGGCTCAATGGGCCCAAGTTCCAG
GAATTCTACTCGCAAGCAACCCTTTTCTGGAACTCAATGTCCGAGACGGAGAGGGAGCATATCATTGCCGCGTACAACTTCGAGTTG
TCACACTGCGCGGAAGACATTGTCATTCAAAACGTCATCAATAGCCTCAATGAAATCGACCACGGGCTTGCTACTTCGGTTCACGCTACCTTCCCTCACCTTACTTTGCCTGAGGCCAAA
CCCACCCACAATAAGAAGTCTGAATATCTGTCGCAAATCAATGGCAAGCACCAAGTCTTCACGGCTTCTGGGAGAAGGATTGGTATTTACCTCGTGCCCGGGTACACCTACTCGCAAGTT
GTACCTTTGCTTGCTGCTTTTGAAGCGGATGGATGTATGGTGAAATTT
ATTGGCCCTACGCTTGGTCCAATCAAGGCTTCAAATGGTCAGTCATTCACCGCCGAATTCACGTTCGAAGGC
TGTCGCACTACCTTCTTTGACGCTATTGTCTTCGTCGGCGGTCCCGATGATTCCTTCATCGCGAAGCTCAAGATTGGCCGACTTATTCATGCAGCAAGGGAGGCTTATATGCACCTTAAA
CCCATTGGCGTACTTGGCAATGCTACCCAATGGATGGTAAACACTTGCTTGCCTGGAGATTTCAGCGAGAAGACCAAGACTGAGTCAAGTGTCGTTGTGGAAAACGGTGTCGTCTTCGCC
CCTGGTGACCCAACCCTCCATTCCATTAAGTTTGCTAAGCAATTCTTGGAGGGGGTCGCCCACCACCGTGTCTGGGACAGGCAAGTTGCGCACATTGCTGCATAG

Retrieve as FASTA