Entry information : CnKat03_H99 (CAT3)
Entry ID 5222
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2012-05-23 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-23 (Christophe Dunand)
Peroxidase information: CnKat03_H99 (CAT3)
Name (synonym) CnKat03_H99 (CAT3)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat03_H99
start..stop
S start..stop
CnKat03_JEC21 1433 0 1..714 1..714
CnKat01_grubiiH99 1292 0 1..714 1..714
CnKat01_JEC21 1270 0 1..714 1..714
CnKat01_B-3501A 1270 0 1..714 1..714
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1486055..1486076 22 N° 2 1485850..1486008 159 N° 3 1485665..1485798 134 N° 4 1485474..1485615 142
N° 5 1485386..1485417 32 N° 6 1484836..1485282 447 N° 7 1484361..1484777 417 N° 8 1483936..1484310 375
N° 9 1483468..1483884 417  
complement(join(1483468..1483884,1483936..1484310,1484361..1484777,1484836..1485 282,1485386..1485417,1485474..1485615,1485665..1485798,1485850..1486008,1486055. .1486076))


exon

Literature and cross-references CnKat03_H99 (CAT3)
Literature Giles S.S., Stajich J.E., Nichols C., Gerrald Q.D., Alspaugh J.A., Dietrich F., Perfect J.R. The Cryptococcus neoformans catalase gene family and its role in antioxidant defense. Eukaryot. Cell 5:1447-1459(2006).
Protein ref. UniProtKB:   Q15EU5
DNA ref. JGI genome:   cneoH99_Chr1 (1486076..1483468)
Protein sequence: CnKat03_H99 (CAT3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   714
PWM (Da):   %s   79913.06  
PI (pH):   %s   6.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQMLNQAANMVTGDAKYRQMAENTIDQDDKTPYTTYFGVKVSDTDNSLRAGARGPTLLEDFHNREKIQHFDHERIPERVVHARGAGAFGEFKLHTPLTDITTAVLTDTSKVVPAYVRFSAVAGFRGSADTVRDVRGFATRFYTDEGNWDIVGNNMPVFFIDAIKFPDVIHAVQPEPHNQIPQAQTAHDNAWDFMSLHKPALHMQQWLTSDRAVPRSYRMMQGFGVHTFRLINEEGKSTFVKYHWIPHLGTHSLVWDEALKVAGQDPDFHRRDLWDAIEVGAYPKWDLGVQLIKEEDEHKFDFDLLDATKLIPEELVPVQKIGTLTLNRNPVDYFSEVEQVAFCTQHIVPGMDFTDDPLLAGRNFSYPDTQVSRLGINWKDIPVNRPICPFMTTMREGQMSMFSKNNRTPYHPNRNENLPLTSPKQGGFKSYPAKVSGIKERVQAPKFNDHSSQATLFWNSMSDVEKKHIIDAYKFELSHCADNLVIQNVINRINEIDHGLATAVHSGFPHLSLPEAKPNHGKRTEYLSQITGKNQTFTAAGRKIGIFLVPGFVYSQVAPLLAAFEAAGCMVKFVGPTLGPVKASDGQSFTTEFTFEGCRSTYFDALIFAGGPDDAFVSKLKIGRLIHAAREAYMHLKAIGAVGNATQWLVETCIPGDFSPTVKTESSVVQENGVVFAPANPTLHSAQFAKQFLETVANHRVWDREVSHIAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). DNA contains an extra "G" => bad intron for the junction exon 5/intron 5.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGATGTTAAACCAAGGTCAGGAGATTGAGCCTTTGTGTAGATGGAGCTGATACAAGTACAGCCGCCAATATGGTTACAGGCGACGCCAAATATCGTCAGATGGCTGAGAACAC
CATCGATCAAGACGATAAGACCCCTTACACTACGTATTTCGGGGTCAAGGTATCAGACACGGACAATTCCCTTCGAGCTGGAGCCAGGGGACCCACTCTACTTGAAG
GTAGGCTTCTAAT
CTTGGCTGCAGGCTTATGATAATCTGACGTCTCGTAAGACTTCCACAACCGTGAAAAGATTCAGCATTTTGATCACGAACGCATTCCAGAGCGTGTAGTTCACGCCCGGGGTGCCGGCGC
TTTCGGAGAATTCAAGCTTCACACTCCATTGACTGACATCACCACTGCGAAG
GTTTGACAACCTACTCATCGTTCTAGCCGATGTTAACTGACTTTTCCAGGTTTTGACGGACACCAGTA
AGGTCGTACCAGCCTATGTTCGGTTCAGCGCTGTTGCTGGTTTTCGGGGAAGCGCTGACACAGTGCGTGATGTCCGTGGGTTTGCCACAAGATTTTATACGGACGAAGGAAACTGGGATA
TCG
GTAAGAGCTGTCTTTTTTACGCTTCAACAACTTATTACTGATCATATCTCACGTAGTCGGCAACAACATGCCCGTGTTCTTCATTAATGGTAAGTCATCGTAATCCGGCGGCAACAA
TTTTACTGATAATGGTGACAGCAAGTACCTTACTCATAATATTACAGGGCCCACTGGCTGATTCAGGCTTCTAGGATGCGATTAAGTTTCCGGATGTCATTCATGCCGTCCAACCCGAGC
CTCACAATCAGATTCCTCAAGCCCAGACAGCTCACGACAATGCTTGGGACTTCATGTCTCTTCACAAGCCCGCTCTTCACATGCAGCAATGGCTCACGTCTGATCGGGCGGTTCCTCGAT
CGTACCGCATGATGCAAGGGTTTGGCGTTCATACTTTCCGACTCATCAATGAGGAAGGCAAAAGCACCTTCGTTAAATATCATTGGATACCACACCTTGGTACTCACTCTCTTGTGTGGG
ATGAGGCGCTGAAGGTTGCAGGACAGGACCCTGATTTCCACCGAAGAGACCTTTGGGACGCAATCGAAGTTGGAGCGTACCCCAAATGGGATTTGGGTGTGCAGTTGATTAAAGAAGAAG
ATGAGCACAAATTTGATTTTGATCTCCTTGATGCCACCAAG
GTAATTCTTACTCCCTTTCAACTCAGTTGAAATTAGCAAATACTCACCACCTACATAGCTTATCCCTGAGGAGCTTGTG
CCGGTTCAAAAAATTGGTACCCTTACACTCAATCGCAATCCTGTCGACTATTTTAGTGAAGTCGAACAGGTTGCTTTCTGTACTCAGCACATCGTTCCCGGCATGGACTTTACCGATGAT
CCTCTCCTAGCTGGTCGAAACTTTTCCTATCCTGATACCCAGGTATCTCGCCTAGGCATCAATTGGAAAGATATCCCTGTGAACAGGCCTATTTGTCCCTTCATGACCACTATGCGAGAA
GGTCAAATGAGCATGTTTAGTAAGAACAATAGAACACCTTATCATCCAAACAGGAATGAAAATCTCCCTCTTACATCGCCTAAGCAGGGAGGTTTTAAAAGCTATCCTGCAAAGGTGTCG
GGCATTAAAGAACGAGTTCAGGCCCCCAAATTCAAC
GTATGTCTCTCAATGTGTATGTGTCAGTCAGTATTGCTAATAAGGCGCAGGATCATTCCTCACAAGCCACTCTTTTCTGGAACT
CTATGAGCGATGTGGAAAAGAAACATATCATTGACGCATATAAATTTGAACTTTCACACTGTGCTGATAATTTGGTCATACAAAATGTCATCAACCGTATCAATGAAATCGACCATGGAC
TTGCTACTGCAGTCCATTCCGGCTTCCCCCATCTGAGCCTGCCTGAAGCCAAACCCAACCATGGTAAGAGGACAGAATATCTGTCTCAGATTACGGGTAAAAATCAAACCTTCACTGCTG
CCGGGAGGAAAATTGGTATTTTCCTTGTGCCAGGGTTCGTTTACTCGCAAGTCGCTCCCCTGCTTGCAGCTTTCGAAGCTGCTGGATGTATGGTGAAGTTT
GTGAGTGCCATTATGACAC
CTCGCCGTGAACTTGTATTGAGACGTCTCTAGGTTGGTCCTACTCTCGGTCCTGTCAAAGCCTCTGATGGCCAGTCATTCACTACGGAGTTTACTTTCGAAGGTTGCCGATCCACATATT
TCGACGCTCTTATCTTCGCTGGCGGTCCTGATGATGCCTTCGTATCCAAGCTCAAAATTGGTCGCCTCATTCACGCAGCTCGAGAGGCCTACATGCATCTGAAGGCGATTGGGGCAGTCG
GCAATGCTACGCAATGGTTGGTTGAGACATGTATTCCTGGAGATTTTAGCCCCACGGTCAAGACAGAATCTAGTGTGGTGCAAGAGAATGGCGTCGTGTTCGCGCCCGCCAACCCCACTC
TCCACTCTGCACAATTTGCCAAGCAATTTTTGGAGACAGTTGCCAATCATAGGGTTTGGGACAGAGAAGTCTCGCACATCGCTGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGATGTTAAACCAAGCCGCCAATATGGTTACAGGCGACGCCAAATATCGTCAGATGGCTGAGAACACCATCGATCAAGACGATAAGACCCCTTACACTACGTATTTCGGGGTC
AAGGTATCAGACACGGACAATTCCCTTCGAGCTGGAGCCAGGGGACCCACTCTACTTGAAG
ACTTCCACAACCGTGAAAAGATTCAGCATTTTGATCACGAACGCATTCCAGAGCGTGTA
GTTCACGCCCGGGGTGCCGGCGCTTTCGGAGAATTCAAGCTTCACACTCCATTGACTGACATCACCACTGCGAAG
GTTTTGACGGACACCAGTAAGGTCGTACCAGCCTATGTTCGGTTC
AGCGCTGTTGCTGGTTTTCGGGGAAGCGCTGACACAGTGCGTGATGTCCGTGGGTTTGCCACAAGATTTTATACGGACGAAGGAAACTGGGATATCG
TCGGCAACAACATGCCCGTGTTC
TTCATTAAT
GATGCGATTAAGTTTCCGGATGTCATTCATGCCGTCCAACCCGAGCCTCACAATCAGATTCCTCAAGCCCAGACAGCTCACGACAATGCTTGGGACTTCATGTCTCTTCAC
AAGCCCGCTCTTCACATGCAGCAATGGCTCACGTCTGATCGGGCGGTTCCTCGATCGTACCGCATGATGCAAGGGTTTGGCGTTCATACTTTCCGACTCATCAATGAGGAAGGCAAAAGC
ACCTTCGTTAAATATCATTGGATACCACACCTTGGTACTCACTCTCTTGTGTGGGATGAGGCGCTGAAGGTTGCAGGACAGGACCCTGATTTCCACCGAAGAGACCTTTGGGACGCAATC
GAAGTTGGAGCGTACCCCAAATGGGATTTGGGTGTGCAGTTGATTAAAGAAGAAGATGAGCACAAATTTGATTTTGATCTCCTTGATGCCACCAAG
CTTATCCCTGAGGAGCTTGTGCCG
GTTCAAAAAATTGGTACCCTTACACTCAATCGCAATCCTGTCGACTATTTTAGTGAAGTCGAACAGGTTGCTTTCTGTACTCAGCACATCGTTCCCGGCATGGACTTTACCGATGATCCT
CTCCTAGCTGGTCGAAACTTTTCCTATCCTGATACCCAGGTATCTCGCCTAGGCATCAATTGGAAAGATATCCCTGTGAACAGGCCTATTTGTCCCTTCATGACCACTATGCGAGAAGGT
CAAATGAGCATGTTTAGTAAGAACAATAGAACACCTTATCATCCAAACAGGAATGAAAATCTCCCTCTTACATCGCCTAAGCAGGGAGGTTTTAAAAGCTATCCTGCAAAGGTGTCGGGC
ATTAAAGAACGAGTTCAGGCCCCCAAATTCAAC
GATCATTCCTCACAAGCCACTCTTTTCTGGAACTCTATGAGCGATGTGGAAAAGAAACATATCATTGACGCATATAAATTTGAACTT
TCACACTGTGCTGATAATTTGGTCATACAAAATGTCATCAACCGTATCAATGAAATCGACCATGGACTTGCTACTGCAGTCCATTCCGGCTTCCCCCATCTGAGCCTGCCTGAAGCCAAA
CCCAACCATGGTAAGAGGACAGAATATCTGTCTCAGATTACGGGTAAAAATCAAACCTTCACTGCTGCCGGGAGGAAAATTGGTATTTTCCTTGTGCCAGGGTTCGTTTACTCGCAAGTC
GCTCCCCTGCTTGCAGCTTTCGAAGCTGCTGGATGTATGGTGAAGTTT
GTTGGTCCTACTCTCGGTCCTGTCAAAGCCTCTGATGGCCAGTCATTCACTACGGAGTTTACTTTCGAAGGT
TGCCGATCCACATATTTCGACGCTCTTATCTTCGCTGGCGGTCCTGATGATGCCTTCGTATCCAAGCTCAAAATTGGTCGCCTCATTCACGCAGCTCGAGAGGCCTACATGCATCTGAAG
GCGATTGGGGCAGTCGGCAATGCTACGCAATGGTTGGTTGAGACATGTATTCCTGGAGATTTTAGCCCCACGGTCAAGACAGAATCTAGTGTGGTGCAAGAGAATGGCGTCGTGTTCGCG
CCCGCCAACCCCACTCTCCACTCTGCACAATTTGCCAAGCAATTTTTGGAGACAGTTGCCAATCATAGGGTTTGGGACAGAGAAGTCTCGCACATCGCTGCGTAG

Retrieve as FASTA