Entry information : PgrKat01
Entry ID 5243
Creation 2007-05-30 (Christophe Dunand)
Last sequence changes 2007-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Laure Collomb
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PgrKat01
Name PgrKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrKat01
start..stop
S start..stop
PplKat01 669 0 1..512 1..505
CcinKat01 651 0 1..516 1..519
LbiKat01 643 0 1..516 1..519
PcarKat01 638 0 1..515 1..508
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 87119..87177 59 N° 2 87259..87598 340 N° 3 87662..87777 116 N° 4 87883..88039 157
N° 5 88138..88319 182 N° 6 88393..88417 25 N° 7 88496..88563 68 N° 8 88637..89221 585
N° 9 89311..89371 61  
join(87119..87177,87259..87598,87662..87777,87883..88039,88138..88319,88393..884 17,88496..88563,88637..89221,89311..89371)


exon

Literature and cross-references PgrKat01
Literature Unpublished, sequencing project at Broad Institute
DNA ref. JGI genome:   supercontig_2_58 (87119..89371)
Protein sequence: PgrKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   530
PWM (Da):   %s   59675.98  
PI (pH):   %s   7.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSAKANESSDDAVYTTSGGNPYPEPYEAQRLGTNGPLLLQDYHHIDLLQHFHRERIPERVVHAKGSGALGYLEITHDISDICCAKLFNKVGKKAPVVVRFSTVGGERGSPDTARDPRGFSIKIKTEEGIWDVFNNTPVFFLRDPVKFPHFIHTQKRYPQSNLSHGDDPDMFWDYLSQNPESIHQVMILFGDRGVPDGYRGMNAYSGHTFKFVNASGSFKYVIHCLADQKRGEFLTQEESVKKAGESPDHSTKDLFDAIERKEYPSWTCYVQEMSAEQAQKFRYNILDLTVWPHKEFPLRPFAKFVLNENPINYHAQIEQVAFSPSHLPPGVEPSADPVLQSRLFSYNDAHIYRLGINYTQLPVNESVSPVANFQRDGRMALGDNQGKRPNYKSTIKPMKYPQRPYQFPGDHEVFIGQAVADLSTVTELDFEPARALWSKVFDDGAKERFVKNVSGHLGNVSLDRIKKDQVAIFLAVDKDLGTRVAKAIGLKDMPEPYKPEPAAQATKFAPNLKSSGQMIFGNSIPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). No EST available. Strain="CRL 75-36-700-3".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCTGCTAAGGCGAATGAGAGCAGTGACGACGCCGTGTATACTACCTCTGGAGGGTACGTCAATCTCGGGCCTCGCTTTGCTATCCCTTACTTTGAAGAGGGGCTGACACCAACC
CTTGGAATGATTTAATTCAGGAATCCGTATCCCGAGCCTTACGAGGCTCAAAGGTTAGGAACCAATGGTCCATTGCTACTTCAAGATTACCATCACATCGATCTCCTTCAGCATTTCCAT
CGTGAACGTATCCCTGAACGTGTGGTCCATGCCAAGGGATCGGGTGCCTTAGGCTATCTTGAAATCACGCACGATATCTCTGATATCTGTTGTGCAAAGCTGTTCAACAAGGTCGGTAAA
AAAGCCCCGGTGGTCGTCAGATTCTCGACTGTCGGTGGTGAAAGAGGCTCCCCAGATACTGCCAGAGACCCTCGTGGTTTCTCTATCAAGATCAAGACGGAGGAGGGTATTTGGGACTGG
GTGAGGTTATCAAACGACGCATAGCAAATCTTCACTCCAAACTGATCTCGAACTTTTTGTTAGGTTTTCAACAACACCCCTGTCTTCTTCCTCAGGGACCCGGTCAAATTTCCCCATTTC
ATCCACACTCAAAAGAGATATCCTCAGTCAAATTTATCTCACGGTGATGATCCCGACAT
GTGCGCAGATACTCTCTTTTATGCAATTTTTTCCTTAAATACTGTCTTCTCGGAGACTTTT
GTTTTTCTTGCAACTGATCCTGGGTCCTTGTGATCTAAAAAAAGGTTTTGGGATTACTTGTCCCAAAACCCAGAGTCGATTCACCAGGTCATGATCTTATTTGGTGACCGTGGTGTACCC
GATGGTTATCGTGGGATGAACGCGTATTCGGGCCATACTTTCAAGTTCGTTAATGCATCTGGAAGTTTCAAATATGTCCAG
GTAAGTGGTCTGCAGAGCAATGGGCTAGAATCGAAGCCT
CTTGACCCCGCAGTAGTACTCATTTTCTGTGATGAATCCATCATCCATTCAAATGAAAGATTCATTGTTTGGCAGATCAAAAACGAGGTGAATTCTTAACGCAAGAAGAATCTGTTAAGA
AGGCAGGCGAAAGCCCCGATCACTCTACCAAGGACTTATTTGATGCGATTGAACGAAAGGAGTACCCTTCTTGGACTTGCTATGTCCAAGAGATGTCCGCTGAGCAAGCGCAAAAGTTTC
G
GTAAGGCAATGTAGAATCTTGGATACTTACATAGAAAACTTTGACTTACGATACGGTCTGAAATTTAACACAGATACAACATTTTGGACCTTACAAAGGTTTGATTCCAATATCTTGAT
TTTGTTAATTTCGAGCAGTGGACAGGAGAAACTGACAGCTTTCCATATCCCTCTTAGGTATGGCCCCACAAAGAGTTCCCGTTGCGTCCTTTTGCTAAATTCGTGTTGAATGAAAACCCG
ATCAA
GTCAGCACATCTTGTTTAGTTCGAATTTTTTATCTTGGTGGGATCATTTGCTGATGCCTTGAATGATTTTCAGTTACCACGCTCAAATCGAGCAAGTGGCTTTCTCGCCGTCTCA
TCTCCCGCCGGGAGTCGAGCCAAGTGCCGATCCAGTACTTCAATCCCGACTGTTCTCTTACAACGATGCTCACATTTACAGATTAGGAATCAACTATACTCAGCTTCCTGTTAATGAATC
TGTCAGCCCAGTCGCCAACTTTCAACGAGATGGACGTATGGCGTTAGGCGATAACCAAGGGAAAAGACCCAATTACAAGAGCACGATCAAACCGATGAAATATCCTCAAAGACCTTATCA
ATTCCCCGGAGATCATGAGGTTTTCATCGGCCAAGCAGTCGCTGACCTCTCAACAGTCACGGAACTAGACTTCGAGCCTGCTCGTGCGCTGTGGTCGAAAGTCTTTGACGATGGCGCCAA
AGAACGTTTTGTCAAAAACGTCAGCGGACATCTTGGGAACGTCAGTCTTGATCGCATCAAGAAGGATCAAGTTGCTATATTCTTGGCCGTCGACAAAGATTTAGGTACCAGAGTGGCCAA
GGCAATCGGTCTTAAAGATATGCCTGAGCCTTACAAACCCGAGCCTGCAGCTCAAGCAACTAA
GTGAGTCATTGCGCCGATCCTTTGTCGATCCGCAAAAAAAAATTCTGTAGTTACTAA
ATCAAGTGTCTTGCTTGAACATTTTTTGATAGGTTTGCTCCGAACTTGAAGTCTTCGGGTCAAATGATCTTTGGAAATAGCATTCCAGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCTGCTAAGGCGAATGAGAGCAGTGACGACGCCGTGTATACTACCTCTGGAGGGAATCCGTATCCCGAGCCTTACGAGGCTCAAAGGTTAGGAACCAATGGTCCATTGCTACTT
CAAGATTACCATCACATCGATCTCCTTCAGCATTTCCATCGTGAACGTATCCCTGAACGTGTGGTCCATGCCAAGGGATCGGGTGCCTTAGGCTATCTTGAAATCACGCACGATATCTCT
GATATCTGTTGTGCAAAGCTGTTCAACAAGGTCGGTAAAAAAGCCCCGGTGGTCGTCAGATTCTCGACTGTCGGTGGTGAAAGAGGCTCCCCAGATACTGCCAGAGACCCTCGTGGTTTC
TCTATCAAGATCAAGACGGAGGAGGGTATTTGGGACTGG
GTTTTCAACAACACCCCTGTCTTCTTCCTCAGGGACCCGGTCAAATTTCCCCATTTCATCCACACTCAAAAGAGATATCCT
CAGTCAAATTTATCTCACGGTGATGATCCCGACAT
GTTTTGGGATTACTTGTCCCAAAACCCAGAGTCGATTCACCAGGTCATGATCTTATTTGGTGACCGTGGTGTACCCGATGGTTAT
CGTGGGATGAACGCGTATTCGGGCCATACTTTCAAGTTCGTTAATGCATCTGGAAGTTTCAAATATGTCCAG
ATTCATTGTTTGGCAGATCAAAAACGAGGTGAATTCTTAACGCAAGAA
GAATCTGTTAAGAAGGCAGGCGAAAGCCCCGATCACTCTACCAAGGACTTATTTGATGCGATTGAACGAAAGGAGTACCCTTCTTGGACTTGCTATGTCCAAGAGATGTCCGCTGAGCAA
GCGCAAAAGTTTCG
ATACAACATTTTGGACCTTACAAAGGTATGGCCCCACAAAGAGTTCCCGTTGCGTCCTTTTGCTAAATTCGTGTTGAATGAAAACCCGATCAATTACCACGCTCAA
ATCGAGCAAGTGGCTTTCTCGCCGTCTCATCTCCCGCCGGGAGTCGAGCCAAGTGCCGATCCAGTACTTCAATCCCGACTGTTCTCTTACAACGATGCTCACATTTACAGATTAGGAATC
AACTATACTCAGCTTCCTGTTAATGAATCTGTCAGCCCAGTCGCCAACTTTCAACGAGATGGACGTATGGCGTTAGGCGATAACCAAGGGAAAAGACCCAATTACAAGAGCACGATCAAA
CCGATGAAATATCCTCAAAGACCTTATCAATTCCCCGGAGATCATGAGGTTTTCATCGGCCAAGCAGTCGCTGACCTCTCAACAGTCACGGAACTAGACTTCGAGCCTGCTCGTGCGCTG
TGGTCGAAAGTCTTTGACGATGGCGCCAAAGAACGTTTTGTCAAAAACGTCAGCGGACATCTTGGGAACGTCAGTCTTGATCGCATCAAGAAGGATCAAGTTGCTATATTCTTGGCCGTC
GACAAAGATTTAGGTACCAGAGTGGCCAAGGCAATCGGTCTTAAAGATATGCCTGAGCCTTACAAACCCGAGCCTGCAGCTCAAGCAACTAA
GTTTGCTCCGAACTTGAAGTCTTCGGGT
CAAATGATCTTTGGAAATAGCATTCCAGCTTAG

Retrieve as FASTA