Entry information : GmPrx36 (Glyma16g27900.1)
Entry ID 526
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx36 (Glyma16g27900.1)
Name (synonym) GmPrx36 (Glyma16g27900.1)
Class Class III peroxidase    [Orthogroup: Prx235]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Germinating shoots
Leaves
Roots
Roots hairs
Roots of 'Supernod' plants
Somatic embryos
Inducer Cyst nematode infection
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx36
start..stop
S start..stop
PvPrx16 473 9e-169 1..325 1..334
MtPrx75 456 1e-162 1..333 1..336
GmPrx32 403 3e-141 2..345 8..352
PvPrx14 379 6e-132 1..345 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31842594..31842830 237 N° 2 31841700..31841885 186 N° 3 31840249..31840863 615  
complement(join(31840249..31840863,31841700..31841885,31842594..31842830))


exon

Literature and cross-references GmPrx36 (Glyma16g27900.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm16 (31842830..31840249)
Cluster/Prediction ref. UniGene:   Gma.6477
Protein sequence: GmPrx36 (Glyma16g27900.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (325)
PWM (Da):   %s   38107.62 (35846.3)  
PI (pH):   %s   6.4 (6.25) Peptide Signal:   %s   cut: 21 range:21-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARVSPLFHSLLLISSLVLASQIHVSSGKLVPGLSWNYYLLTCPKLERIIRKHLEDVFEKDSGVAPGILRLFFHDCFPNGCDASILLNGDGDEKQHRANFGLRQEAIDAIENLRVLIYKQCLPVVSCSDILVIAAREAVRQLGGPDFDVPLGRKDGLGPNATAPDNLPAPFFRTDDLLRGFGNRGFDATDVVALSGAHTYGRAHCPSLVNRTIETDPPIDPNFNNNLIATCPNAESPNTVNLDVRTPVKFDNMYYINLLNRQGVFTSDQDIAGSPKTKEIVNQFASDQKLFFKKFSDAFVKVSQLDVITDRIGKGEIRDKCFVANKRRSSMASVVEEVVELAQEI*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 65 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGGTTAGTCCTTTGTTTCACTCTTTGCTCTTGATTTCTTCCCTTGTATTGGCTTCTCAAATCCATGTTTCCTCTGGGAAACTAGTCCCTGGACTATCATGGAATTACTATTTG
TTGACATGTCCCAAGCTTGAGAGGATTATAAGGAAGCATCTTGAGGATGTCTTCGAGAAGGACAGTGGAGTAGCTCCTGGCATACTTCGACTCTTCTTCCATGACTGCTTTCCTAAT
GTA
AGACTACTTGAGACAATTTCCCAAACCCTAACTCCCATCTTTATTTCTTATTCTCAACCTTAACTTCCAATGCTGTGATTGACACTTCAATCAATTAGCTTATAAGTTTTCACTTAATTT
TTCAATCCTAACTTATGACTTATATATACGCTTTGACAATCTTAATTATAAGTTAGTCTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATATAATATTTTCTTAAGTTCTTGACTCTAAGTCTCATTTCTTATAGTAAATATACAGATAAAACTGTGCAAGTGATATTGGAATATCCAGAATCAAACAATTTC
CTTTTATCATACAACCAAGCAATCTCCTAAAAGAGCTGCCACTTGACGAGCTACAACTTTTTTTTTCCCTCCATTTTCAAACGAAAAGTTGATTATTTCGCATCACTTTTTTTTTGCATA
CAAAGGAAGTATAAGAAAAAGTGATTTAAGAGAAATATTTTTTCTTTTTCAATTTCCAAATAACCTTATTCAATCGATGATATTGATGATTTGGACTGCAAACAGGGATGCGATGCGTCT
ATATTGTTGAATGGAGACGGTGACGAGAAGCAACACCGTGCTAACTTTGGTTTAAGGCAAGAGGCCATTGACGCCATTGAAAACCTTCGGGTTCTCATTTACAAGCAGTGTCTACCAGTT
GTCTCATGCTCAGACATCCTTGTTATCGCAGCACGTGAAGCTGTTCGCCAA
GTACGTAATCATTTTCGTTCACTATTTAATTTCTTCTGGCACTATTTCTTCCGTGATTATTAAGTATAT
TTAAATATATTTTTAGTTAACTCAAATAATGTTTTTAATAATATTATTATGAAAATCCATTATGAGTTTAATTATGTGTTTAATAACAGATCATCTGACCATTATAGGTGAGACTCATCA
CGTGATTTTTTTTATAAAAATTCTAGTTCCTAAAATAAATCTTATTTGTCTTCTGAAAATAACCTTAAATACTAAAAATTATGATTTCTATTGAGAAAAATCTAAATCGATCTCCCATCT
ACTATAAAGATATAAGTGTCAAGATAATGTATATATAAGTAGAAAAGTAGAACACAAATTCTTACATGTAAACTAACTTTTTTGAAGACTCATCAAATTTTTTCTTAAATTCATTATTGA
GTCACATATCATATTATCTATGTAACAACTCTAATAATCTTCAACACCATATTGAGAAAAGAGAAAAAAGATGCATGAAAAACGTGAAGAATGAGTTATTGATTGTTATTTTTTTTAAAA
AAAAATAATTACAAATTAAAAATTAGAAAATGTAGATCAATTTTTATTAATGAAAAACAACCTTCTTGTGATTACCATCAAATTAATGAAAAACTAATCAAAATTTCTCGAGAAAAATTT
ATATATCACATTCATTAAAAATAACATAATCAAAATCATTTATAATATATAAATTAGAGATAATTTTCACTCAAATTATAACATTATAATGAGATTAAAAACACATTTAAACATAATGCT
TGATCTCTCGTTTGTTCCTTTTGGTAACTTCTTTGTAATTTGAACAGTTAGGAGGCCCTGATTTTGACGTGCCACTGGGAAGAAAAGACGGCCTAGGACCAAACGCCACCGCGCCGGACA
ACCTACCGGCACCATTCTTCCGAACCGACGATCTTCTGAGAGGATTCGGAAATAGAGGTTTCGATGCCACCGATGTGGTCGCTCTCTCCGGCGCACACACCTACGGTCGTGCCCACTGTC
CCTCCCTAGTGAACAGAACCATCGAAACGGACCCACCAATCGACCCAAACTTCAACAACAATTTGATAGCTACGTGTCCCAATGCCGAGTCCCCCAACACCGTTAATTTGGACGTGAGAA
CCCCCGTGAAGTTCGACAACATGTATTACATCAACCTCTTGAACCGCCAAGGAGTGTTCACTTCTGACCAGGACATCGCGGGCAGCCCCAAAACCAAGGAAATCGTGAACCAGTTCGCTT
CAGACCAGAAACTGTTTTTTAAGAAATTTTCCGATGCTTTTGTGAAGGTGAGCCAGCTAGATGTGATAACGGATCGTATTGGGAAAGGGGAGATTCGTGATAAGTGCTTTGTTGCAAATA
AGAGAAGATCTTCTATGGCGTCTGTGGTGGAAGAAGTAGTGGAATTGGCTCAGGAGATATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGGTTAGTCCTTTGTTTCACTCTTTGCTCTTGATTTCTTCCCTTGTATTGGCTTCTCAAATCCATGTTTCCTCTGGGAAACTAGTCCCTGGACTATCATGGAATTACTATTTG
TTGACATGTCCCAAGCTTGAGAGGATTATAAGGAAGCATCTTGAGGATGTCTTCGAGAAGGACAGTGGAGTAGCTCCTGGCATACTTCGACTCTTCTTCCATGACTGCTTTCCTAAT
GGA
TGCGATGCGTCTATATTGTTGAATGGAGACGGTGACGAGAAGCAACACCGTGCTAACTTTGGTTTAAGGCAAGAGGCCATTGACGCCATTGAAAACCTTCGGGTTCTCATTTACAAGCAG
TGTCTACCAGTTGTCTCATGCTCAGACATCCTTGTTATCGCAGCACGTGAAGCTGTTCGCCAA
TTAGGAGGCCCTGATTTTGACGTGCCACTGGGAAGAAAAGACGGCCTAGGACCAAAC
GCCACCGCGCCGGACAACCTACCGGCACCATTCTTCCGAACCGACGATCTTCTGAGAGGATTCGGAAATAGAGGTTTCGATGCCACCGATGTGGTCGCTCTCTCCGGCGCACACACCTAC
GGTCGTGCCCACTGTCCCTCCCTAGTGAACAGAACCATCGAAACGGACCCACCAATCGACCCAAACTTCAACAACAATTTGATAGCTACGTGTCCCAATGCCGAGTCCCCCAACACCGTT
AATTTGGACGTGAGAACCCCCGTGAAGTTCGACAACATGTATTACATCAACCTCTTGAACCGCCAAGGAGTGTTCACTTCTGACCAGGACATCGCGGGCAGCCCCAAAACCAAGGAAATC
GTGAACCAGTTCGCTTCAGACCAGAAACTGTTTTTTAAGAAATTTTCCGATGCTTTTGTGAAGGTGAGCCAGCTAGATGTGATAACGGATCGTATTGGGAAAGGGGAGATTCGTGATAAG
TGCTTTGTTGCAAATAAGAGAAGATCTTCTATGGCGTCTGTGGTGGAAGAAGTAGTGGAATTGGCTCAGGAGATATAA

Retrieve as FASTA