Entry information : PbrKat02 ( PbrKatP)
Entry ID 5265
Creation 2007-04-17 (Marcel Zamocky)
Last sequence changes 2016-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-27 (Achraf Jemmat)
Peroxidase information: PbrKat02 ( PbrKatP)
Name (synonym) PbrKat02 ( PbrKatP)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Paracoccidioides
Organism Paracoccidioides brasiliensis    [TaxId: 121759 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbrKat02
start..stop
S start..stop
CimKat02 853 0 1..499 1..499
AnKat03 812 0 1..491 1..490
AniKat02 811 0 1..492 1..492
AorKat03 812 0 1..492 1..491
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..22 22 N° 2 216..268 53 N° 3 397..573 177 N° 4 664..1920 1257
join(1..22,216..268,397..573,664..1920)


exon

Literature and cross-references PbrKat02 ( PbrKatP)
Literature Moreira S.F.I. et al., Monofunctional catalase P of Paracoccidioides brasiliensis: identification, characterization, molecular cloning and expression analysis. Yeast 21:173-182(2004).
Protein ref. GenBank:   AAL34518.2 UniProtKB:   Q8X220
mRNA ref. GenBank:   AF428076.2
Protein sequence: PbrKat02 ( PbrKatP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   502
PWM (Da):   %s   56735.69  
PI (pH):   %s   6.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGADVASSTYRYTETPTYTTSNGCVMDPESSQRVGMKGPLLLQDFHLIDLAHFDRERIPERVVHAKGAGAYGEFEVLDDISDITVIDMLLGVGKKTKCITRFSTVGGEKGSADSARDPRGFSTKFYTEQGNWDWVFNNTPVFFLRDPSKFPIFIHTQKRNPQNNLKDATMFWDYLSTHQESANRSCMHLFSDRGTPILPTGTCNGILGHHITQWTKPDGTFNYVQIHCKTDQGNKTFNNEEATKMAADNPDWHTEDLFKAIERGEYPSWTCTFRSSAPSRLEIRWNVFDLTKVWPQAEVPLRRFGRFTLCENPQNYFAEIEQAAFSPSHMVPGVEPSADPVLQSRLFSYPDTHRHRLGVNYQQIPVNCPLRAFNPYQRDGAMAINGNYGANPNYPSTFRPMEFKPVKACQEHEQWAGAALSKQIPVTDEDFVQPNGLWQVLGRQPGQQENFVHNVSVHLCGAQEKVRKATYCMFSRINADLGARIEKATERLVASQPQSHL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), mRNA and 10 ESTs. Strain="Pb01".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCCGACGTTGCGTCCAGTATGTGCCCTCCAAGGAACTCTCTCTATTTTGTGCTATCCCCTTTGAGCTATTGGCCCAATGACCCCTCTACAGAAGACCCATGGACACATATACAC
CCACACACACACCCCTATATATATATATATATATATATATATATGTATACTATGCTCTCTAATTTGATTGCTGACCACACTACACTGCTCTCTAGGTACTTACCGTTATACTGAAACTCC
CACCTACACCACGTCCAATGGCTGCCCG
GTAAGTCGCCTATCTGCAGAATCTGCTCTATGTCTCAACATGCGACAACCAACCAGGGACGCATAAGAACATGTGGCAGCACAGAATCTCGT
CCGGCTGGCTTGATGCTGACTATCCTGCGGTTCTAGGTCATGGACCCTGAGTCTTCCCAGCGGGTGGGAATGAAAGGCCCCCTGCTCCTCCAGGATTTCCACCTGATTGACCTTGCCCAT
TTCGATCGCGAGCGAATTCCCGAACGAGTGGTCCATGCTAAAGGTGCAGGAGCTTACGGTGAATTCGAAGTCTTGGATGATATCAGCGACATT
GTATGTTAAAACCCCATACGCACATTC
CCGTTGCGCAAGTTTCGTTTCAGGTATCTCGTTTTGGGATAAATTGCTAACGGTACATTGTAGACGGTCATTGATATGCTTTTGGGTGTGGGAAAGAAGACAAAGTGTATTACCCGCTTC
TCCACTGTGGGTGGAGAGAAGGGGTCCGCCGATAGTGCTCGCGATCCTAGAGGGTTCTCCACCAAATTTTACACCGAGCAAGGAAATTGGGACTGGGTCTTCAACAACACCCCAGTCTTC
TTCTTGCGTGATCCATCAAAGTTTCCTATCTTCATTCATACCCAGAAGAGAAACCCACAGAACAACCTGAAGGATGCTACTATGTTCTGGGACTACCTCTCCACCCATCAGGAGTCCGCC
AACAGGTCATGCATGCATCTCTTCAGTGACCGTGGCACCCCGATACTCCCTACCGGCACATGTAACGGTATTCTAGGACACCACATTACACAGTGGACCAAGCCTGACGGAACCTTCAAC
TACGTCCAAATCCACTGCAAGACCGATCAGGGCAACAAGACCTTTAACAACGAAGAAGCCACCAAGATGGCCGCCGATAATCCAGATTGGCATACCGAAGATCTATTCAAAGCCATCGAG
CGCGGCGAATACCCATCCTGGACGTGTACGTTCAGGTCCTCAGCCCCGAGCAGGCTAGAAATCCGCTGGAATGTCTTCGACCTGACCAAAGTCTGGCCTCAGGCGGAGGTGCCCCTCCGC
CGCTTCGGCCGCTTCACCCTCTGCGAGAACCCGCAGAACTACTTCGCGGAAATCGAACAGGCCGCCTTCTCACCCTCCCACATGGTCCCGGGTGTCGAACCATCCGCCGACCCTGTCCTG
CAATCCCGCCTCTTCTCCTATCCAGACACCCACCGCCACCGCCTGGGCGTCAACTACCAGCAGATCCCTGTCAACTGTCCTCTGCGCGCCTTCAACCCGTACCAGCGTGACGGTGCCATG
GCTATCAATGGCAACTACGGCGCCAACCCCAACTACCCATCCACCTTCCGCCCGATGGAGTTCAAGCCCGTCAAGGCCTGCCAGGAGCACGAGCAGTGGGCTGGCGCCGCCTTGTCGAAG
CAAATTCCCGTCACGGATGAGGATTTCGTCCAGCCCAATGGCCTCTGGCAGGTTCTTGGACGCCAGCCGGGACAACAGGAGAATTTCGTTCACAATGTGTCCGTCCACCTCTGTGGGGCA
CAGGAGAAAGTGCGCAAGGCCACCTACTGCATGTTTTCGCGCATTAACGCGGACCTTGGAGCGCGGATTGAGAAAGCCACGGAGAGGTTGGTTGCTTCTCAGCCACAGTCGCATCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCCGACGTTGCGTCCAGTACTTACCGTTATACTGAAACTCCCACCTACACCACGTCCAATGGCTGCCCGGTCATGGACCCTGAGTCTTCCCAGCGGGTGGGAATGAAAGGCCCC
CTGCTCCTCCAGGATTTCCACCTGATTGACCTTGCCCATTTCGATCGCGAGCGAATTCCCGAACGAGTGGTCCATGCTAAAGGTGCAGGAGCTTACGGTGAATTCGAAGTCTTGGATGAT
ATCAGCGACATT
ACGGTCATTGATATGCTTTTGGGTGTGGGAAAGAAGACAAAGTGTATTACCCGCTTCTCCACTGTGGGTGGAGAGAAGGGGTCCGCCGATAGTGCTCGCGATCCTAGA
GGGTTCTCCACCAAATTTTACACCGAGCAAGGAAATTGGGACTGGGTCTTCAACAACACCCCAGTCTTCTTCTTGCGTGATCCATCAAAGTTTCCTATCTTCATTCATACCCAGAAGAGA
AACCCACAGAACAACCTGAAGGATGCTACTATGTTCTGGGACTACCTCTCCACCCATCAGGAGTCCGCCAACAGGTCATGCATGCATCTCTTCAGTGACCGTGGCACCCCGATACTCCCT
ACCGGCACATGTAACGGTATTCTAGGACACCACATTACACAGTGGACCAAGCCTGACGGAACCTTCAACTACGTCCAAATCCACTGCAAGACCGATCAGGGCAACAAGACCTTTAACAAC
GAAGAAGCCACCAAGATGGCCGCCGATAATCCAGATTGGCATACCGAAGATCTATTCAAAGCCATCGAGCGCGGCGAATACCCATCCTGGACGTGTACGTTCAGGTCCTCAGCCCCGAGC
AGGCTAGAAATCCGCTGGAATGTCTTCGACCTGACCAAAGTCTGGCCTCAGGCGGAGGTGCCCCTCCGCCGCTTCGGCCGCTTCACCCTCTGCGAGAACCCGCAGAACTACTTCGCGGAA
ATCGAACAGGCCGCCTTCTCACCCTCCCACATGGTCCCGGGTGTCGAACCATCCGCCGACCCTGTCCTGCAATCCCGCCTCTTCTCCTATCCAGACACCCACCGCCACCGCCTGGGCGTC
AACTACCAGCAGATCCCTGTCAACTGTCCTCTGCGCGCCTTCAACCCGTACCAGCGTGACGGTGCCATGGCTATCAATGGCAACTACGGCGCCAACCCCAACTACCCATCCACCTTCCGC
CCGATGGAGTTCAAGCCCGTCAAGGCCTGCCAGGAGCACGAGCAGTGGGCTGGCGCCGCCTTGTCGAAGCAAATTCCCGTCACGGATGAGGATTTCGTCCAGCCCAATGGCCTCTGGCAG
GTTCTTGGACGCCAGCCGGGACAACAGGAGAATTTCGTTCACAATGTGTCCGTCCACCTCTGTGGGGCACAGGAGAAAGTGCGCAAGGCCACCTACTGCATGTTTTCGCGCATTAACGCG
GACCTTGGAGCGCGGATTGAGAAAGCCACGGAGAGGTTGGTTGCTTCTCAGCCACAGTCGCATCTGTGA

Retrieve as FASTA