Entry information : GmPrx38 ( Glyma.09G109800 [a2.v1]/Glyma09g16810.1)
Entry ID 529
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2016-02-24 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-24 (Achraf Jemmat)
Peroxidase information: GmPrx38 ( Glyma.09G109800 [a2.v1]/Glyma09g16810.1)
Name (synonym) GmPrx38 ( Glyma.09G109800 [a2.v1]/Glyma09g16810.1)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Seedlings
Stems
Inducer Sudden Death Syndrome disease
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx38
start..stop
S start..stop
GmPrx71 612 0 1..331 1..331
PvPrx05 576 0 7..331 10..334
GmPrx136 551 0 4..331 3..330
MtPrx23 545 0 1..331 45..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20271169..20271384 216 N° 2 20270825..20271019 195 N° 3 20269985..20270150 166 N° 4 20269167..20269585 419
complement(join(20269167..20269585,20269985..20270150,20270825..20271019,2027116 9..20271384))


exon

Literature and cross-references GmPrx38 ( Glyma.09G109800 [a2.v1]/Glyma09g16810.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm09 (20271813..20269515)
Protein sequence: GmPrx38 ( Glyma.09G109800 [a2.v1]/Glyma09g16810.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (306)
PWM (Da):   %s   34893.03 (32098.5) Transmb domain:   %s   i5-22o
PI (pH):   %s   4.37 (4.43) Peptide Signal:   %s   cut: 26 range:26-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSAINYSLLATIFLVLTLIFPSEGQLSSTFYSSTCSNVSSIVRSAVQQALQSDSRIGASLSRLHFHDCFVNGCDASILLDQGGNITQSEKNAAPNVNSIRGFDVVDNIKSSLESSCPGVVSCADILALAAESSVSLSGGPSWNVLLGRRDGLTANQAGANSSIPSPFESLANVTSKFSAVGLDTTDLVALSGAHTFGRAQCQFFSQRLFNFSGTGSPDPTLNSTYLATLQQNCPQSGSGSTLNNLDPSTPDTFDNNYFTNLLINQGLLQTDQELFSSNGSSTISIVNNFANNQSAFFEAFVQSMINMGNISPLTGSQGEIRTDCKKLNGS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTGCTATTAATTATTCCCTTCTTGCAACCATTTTCTTAGTGCTAACCTTAATTTTTCCTTCAGAAGGCCAATTGAGTTCAACCTTCTATTCTAGCACATGCTCCAATGTGTCT
TCTATAGTGAGGAGTGCTGTTCAGCAGGCTCTTCAATCTGATTCACGAATTGGTGCAAGCCTCTCTCGCCTCCACTTTCATGATTGCTTTGTCAAT
GTAAAATCCCACAACTGAAATCTC
CATTTTAATTTATTATTTTCTCAACAATTATTTAGTTTGATCATAATTTAACTTCTTAATTTGTGTTGTATTATAGGTTTCCAATTAGAAGATTAATAATTAATGATTTTTTTTTTCTGT
TTTAGGGGTGTGATGCGTCCATTTTGTTAGACCAAGGTGGTAACATCACACAAAGTGAGAAAAATGCTGCTCCCAACGTCAATTCCATTCGAGGCTTTGATGTTGTTGATAACATCAAGA
GCTCCCTCGAAAGTTCATGCCCTGGAGTTGTATCTTGTGCTGATATTCTTGCTCTTGCAGCAGAATCTTCTGTGTCCTTG
GTAACTTTCTTGCTATCTAGCTATTACAAGATTTTCCTTT
TTATTAACATACTACTACTATATAATATACACAATTAGAATCTTTGAAAGTACTTATAAGAAGCTTATGAAAGTAATTTGTTCTTTTGAACTTTATTCCAATAATTAAATTTCTGAGTGA
AACATAATAATAGACTGATTTAATGTGAAAACTTAATGAATAAATAGTTAGTTAAATTACTTAGTTAATTGCGCACTCTCGAAATCAATGTATCAATGAATAAAATTATATTTTTTTATC
CTAAATTTTGATAAGTTAGTCTTTTAATTCTTTACCATGATAAATTGATACTTTAATACGATTTTTAGTTGTCATTAATTAAATTTTAATTTTAACCGTTTGAATTTATATTTTAAAATT
ATCATAAAATATTAAAAAATTATATCAATGATTAAAAAAATATTTTTAAATTCAGGAACTAAAAACACACATCTCAAAACACGGGATTAAAATAATAATTAAATCATTATTTAATCTAAA
AATCGACGTAAAAGCAACTAAAGGCGTTTGATCATTTTGATTTGATGCCACGACTTTTTCATAACATCATTTATCACGTTATTTTCTACTTTCTTTAACAATGAATACTAATTATTTGAG
GCAAGACAATAATAAAAAGTGTAAAATTTTGCAGTCAGGAGGACCTTCATGGAACGTACTACTTGGAAGAAGGGACGGTTTAACTGCAAACCAAGCTGGTGCCAATAGTTCCATTCCCTC
TCCATTTGAGAGCCTTGCCAATGTCACTTCCAAATTCTCTGCTGTTGGCTTAGACACAACCGATCTTGTTGCATTATCTG
GTAATTACAACATTTTATTCCTCAAGCAAATAAGTTATTA
TATAGTCCGCAAGTATGTGATCACGATTAATTTTCACATGACATATAGTTAAGTTTTCATATCATAAATTAAAAAATATGATTATTTATCGTACGAAAATTGGTTAAGATTATAGTCTAA
GTTAGAAAATATTATCAAATAGCTCGAGACTCTATCATATGTCTATAGTCTCAACTAGTCAATGTGACATGTATTTAAATTTATACATTTACAAGAAAGTTAATAGTATTAATTTGACTG
GATGTTATGTGGAGATTGATGAGGATTATAATAATATTGAGAATCTAGTAATTTCTTTCTAATCAAAACATGTACTACTTTATTGTTCCTAGTTGATTCAAATTGGACTTTTTCATTAGG
TGCACACACTTTTGGTCGTGCCCAATGCCAATTTTTCTCCCAAAGGTTATTCAACTTCAGTGGCACAGGAAGCCCTGATCCAACCTTGAACTCAACCTATTTGGCCACTCTTCAGCAAAA
TTGTCCCCAAAGTGGGAGTGGATCTACATTGAACAACCTTGACCCTTCTACCCCTGACACTTTTGACAACAACTATTTCACCAATCTTCTCATCAACCAAGGTCTTCTCCAAACAGATCA
AGAACTCTTCTCCTCTAATGGCTCTTCCACAATCTCCATCGTTAACAACTTTGCCAACAACCAATCAGCCTTCTTCGAAGCTTTTGTGCAGTCAATGATCAACATGGGTAACATCAGCCC
TTTGACTGGATCCCAAGGAGAAATTAGAACTGATTGTAAGAAATTGAATGGAAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTGCTATTAATTATTCCCTTCTTGCAACCATTTTCTTAGTGCTAACCTTAATTTTTCCTTCAGAAGGCCAATTGAGTTCAACCTTCTATTCTAGCACATGCTCCAATGTGTCT
TCTATAGTGAGGAGTGCTGTTCAGCAGGCTCTTCAATCTGATTCACGAATTGGTGCAAGCCTCTCTCGCCTCCACTTTCATGATTGCTTTGTCAAT
GGGTGTGATGCGTCCATTTTGTTA
GACCAAGGTGGTAACATCACACAAAGTGAGAAAAATGCTGCTCCCAACGTCAATTCCATTCGAGGCTTTGATGTTGTTGATAACATCAAGAGCTCCCTCGAAAGTTCATGCCCTGGAGTT
GTATCTTGTGCTGATATTCTTGCTCTTGCAGCAGAATCTTCTGTGTCCTTG
TCAGGAGGACCTTCATGGAACGTACTACTTGGAAGAAGGGACGGTTTAACTGCAAACCAAGCTGGTGCC
AATAGTTCCATTCCCTCTCCATTTGAGAGCCTTGCCAATGTCACTTCCAAATTCTCTGCTGTTGGCTTAGACACAACCGATCTTGTTGCATTATCTG
GTGCACACACTTTTGGTCGTGCC
CAATGCCAATTTTTCTCCCAAAGGTTATTCAACTTCAGTGGCACAGGAAGCCCTGATCCAACCTTGAACTCAACCTATTTGGCCACTCTTCAGCAAAATTGTCCCCAAAGTGGGAGTGGA
TCTACATTGAACAACCTTGACCCTTCTACCCCTGACACTTTTGACAACAACTATTTCACCAATCTTCTCATCAACCAAGGTCTTCTCCAAACAGATCAAGAACTCTTCTCCTCTAATGGC
TCTTCCACAATCTCCATCGTTAACAACTTTGCCAACAACCAATCAGCCTTCTTCGAAGCTTTTGTGCAGTCAATGATCAACATGGGTAACATCAGCCCTTTGACTGGATCCCAAGGAGAA
ATTAGAACTGATTGTAAGAAATTGAATGGAAGTTGA

Retrieve as FASTA