Entry information : GmPrx41 (Glyma10g05800.1)
Entry ID 532
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx41 (Glyma10g05800.1)
Name (synonym) GmPrx41 (Glyma10g05800.1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Etiolated hypocotyls
Hypocotyls
Roots
Roots hairs
Roots of 'Supernod' plants
Seed coats
Whole seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx41
start..stop
S start..stop
GmPrx236 611 0 3..327 4..329
LjPrx03 547 0 9..327 7..339
MtPrx56 542 0 25..327 23..325
CsPrx04 520 0 9..327 11..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4542960..4543032 73 N° 2 4541878..4542026 149 N° 3 4541574..4541762 189 N° 4 4540965..4541130 166
N° 5 4539647..4540053 407  
complement(join(4539647..4540053,4540965..4541130,4541574..4541762,4541878..4542 026,4542960..4543032))


exon

Literature and cross-references GmPrx41 (Glyma10g05800.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm10 (4543032..4539647)
Protein sequence: GmPrx41 (Glyma10g05800.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (300)
PWM (Da):   %s   36321.45 (33246.8)  
PI (pH):   %s   6.66 (6.51) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATITKPPSNICFLLLLLLAHFHLGESQVELNYYSKSCPKAEEIIKEQVTQLYNKHGNTAVSWVRNLFHDCVVKSCDASLLLATVSDVVSEQASDRSFGMRNFKYVNTIKAAVEKECPLTVSCADIVALSARDGIALLGGPSIEMKTGRKDSKESYATEVEALIPNHNDSMSSVLSRFQAIGIDVEATVALLGAHSVGRVHCKNLVHRLYPTVDSTLNPAHAEYLKRRCPTPNPDPKAVLYSRNDLKTPMIIDNNYYKNILQHKGLLIVDEELATDPITAPYVQKMANDNDYFNQQFSRAILLLSETNPLTGDEGEIRKDCRYLNAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 14 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCATTACCAAGCCTCCTTCTAATATATGTTTCCTCCTTCTGTTGCTTCTAGCACACTTCCATTTGGGTACGCTAACTATCTGATATTCTACTTACACTTTGGTTTTTTTTTTT
TTTTTTATAACCTATTAGAAAGAGATGGATGACATTAATTTAGATACATTATAAGAATAATTCTTAATCTTCCTACAAATTCTTCCACTCTGATCTTTTATGCTTCCAAAACAATAAATG
TTTTTACTTTTCATTCAATGTTTATCCAATTATTTAGTAGGAAGATTTAGCATTACTCAAATATAGTATGCATTATGGAGTTCATGAGTTTATTTGCAAATAATTATTATTTAATTACTC
CAATTATTTACTCAATCATGGATTTTCCATTTCGATTAATTATTCCTTCGCATTTTTAATTATAGTGATATAGATGACAGGTTTGAAGTTGCACTAATTTTTCCTTAATTATACATAAAC
ACTTACATGTTATATACATATTCAATTTGACACACTTGATTGTTTTTTATCTTTTTTTATATTATATATCATTTATCATATTTATATTTTGTCTCTTTTATCTTTTTTCTCTATGTATAA
TTGGACATACTCCATACACTATTTTCCATTCTTCATCCATAATATATGGATTAATTAAGGGTCTTACTAAACCAATATCCTTTCTCCCAAGGACAGTGGTTAAAAAACTAAAATGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTAACCTTAGCATATTTGTCA
TTAATTAATGATATATAAAGATTCTTACATATATCAAACACCTCATTAATTCTTTCATTTTAATTTATCATGCATATATATTTCTCTGTTTCTCATTCTTGGTGTCAAAATAGTACGTAA
GCAAATCAATGGATTATTTTTCTAATTATATGTTGTACATGTATAGGCGAAAGCCAAGTTGAGTTGAATTACTACTCTAAAAGCTGCCCAAAAGCTGAAGAGATAATCAAGGAACAAGTC
ACACAACTATACAACAAGCATGGAAACACTGCCGTTTCGTGGGTCAGAAATCTCTTCCACGATTGCGTGGTTAAG
GTGCCAGATTTTTATTATCATTATTATTATACACATATCAAGATA
CATGATAATTAGTTAACAACAATATCATATGCATGAAACAGTTAAAAAAATTGATTTGGTTCTGACGCAGTCATGCGATGCATCACTACTGTTAGCGACGGTGAGCGATGTAGTGTCGGA
GCAGGCGTCGGATAGAAGTTTTGGGATGAGAAACTTCAAGTACGTAAACACCATCAAAGCAGCGGTTGAGAAAGAATGCCCCTTGACGGTTTCATGCGCTGACATTGTTGCTCTTTCTGC
TAGAGATGGCATTGCCTTG
GTATGTCTCAATTCCTCTCTTCAGACTCTTCTTCTGTATGCACTTCTATATTCATTTCCCTAATTGAATGTTTCTGATGACCAAAAATGCTAACAATTGTT
TTTAATATTCTTATCAAAGAATTAAATATAGAAATGGTAAAAAATATTTTGAATATGTTTCGAGTGATAAGCTCATATCTGTATCGAGTCTTGTGTATAAGAAAAAAAAAATTGTGAAGA
GATGCTACCAAAAGTAATAAGCCAAATTTTGTAACAAAAATTAGTGGTGGATAAATATGTTACACCAATATTGATGACCCAAAAAAAAAACAATACACTATAATTTTTTCAAAATTATAT
TATGTTTTTTGATGAACTTCTTGTATTTATTACTTTGTTAAAGGACAAATTGCTTAGAGAATTAATTTGAAAATGTGATTTAATTAATGTTGATGTGCGCAGTTGGGAGGACCAAGCATT
GAAATGAAGACAGGGCGAAAGGATAGCAAAGAAAGCTATGCAACGGAGGTGGAAGCCTTGATTCCAAACCACAATGATTCCATGTCCTCAGTGCTGTCTCGTTTTCAAGCCATTGGCATT
GACGTTGAAGCCACAGTCGCTCTTTTAG
GTATAAAAACATGCTGTGTTACACATAATATTGAAATTCTTTAATTCCGATTATAATAACATCTAGTATTTCTAAAGTCAAAATATAATTCA
TTTAAGCGCCTTTATTTACTTAAACGAAACTAATGCTTAAGCAATTAATATATGGACAATTGCCTAACCTATTAGGCAGAAACCCAGACACGACTTCAATATGTTGTAGCTGTCATGATC
ATGTCAAACTAGCCCACTAATATAAAACTTATTCGTATAATTTATACTTTTTTTCCAATTAAATTACTGCCATTATTATATATATTTACTTTGGTCTCAAATATTTTTTAAAAAAATTAT
TCACACTAATTAAAAAAATTAATTAACCACAGTTAATTATATAAATCTCAATTAAATATTAAGTTTTTTTAACAACTTACCCTTGATTGAAATCTAAAGCCAGTAATAAAAATGAGTCAT
AGAAATTAAAGTATAATTTATAGTTATATGCACAATAAAAATTATGAGACTATTTGTATATATCTAAAATGGCATTTGTTGGAAGTGAGAATTCATCTCCCACTAACATGTAAAACTCAT
TTATATATATAAAAAATATATCTATAAATGTTAGTTTATTAGAATATTAATTTTGTTAGTAAAAAGAAATAAAATTCATAATTTTTTCTTAGTGATCCAACTCATTTTATATATCCTCGT
TTACATACTTAAATAACCTTTTGTAATCTATAAAAAAAACTGGGCAATAAAATAAAACATAAATACACTAGCATACTAGCTTTGCATGAGTACTATAGTAATATTTAAGAAGAAGACATG
GTATTTATACAAGAAATATGTATAGATATGTCATGGGATGTGAAAGTTCAAGATAACTTATTTCATGAGTTAACCGAAGCCATTTGTTGGTTGAATTAGGAGCTCACTCGGTTGGAAGAG
TTCACTGCAAGAACCTGGTGCACAGATTATACCCCACCGTGGATTCAACACTAAACCCTGCACACGCTGAGTACCTAAAACGTCGCTGCCCAACACCCAATCCCGATCCAAAAGCTGTTC
TGTATTCTAGGAACGACCTTAAAACGCCCATGATCATTGACAACAACTACTACAAGAACATCTTGCAACACAAGGGTCTTCTAATTGTGGATGAAGAGCTTGCCACTGACCCAATAACTG
CACCTTATGTCCAAAAGATGGCCAACGACAATGATTATTTCAACCAACAATTCTCAAGGGCCATTCTTTTGTTGTCAGAGACCAATCCTTTAACAGGAGATGAAGGTGAAATCAGAAAGG
ATTGTCGCTACCTCAATGCCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCATTACCAAGCCTCCTTCTAATATATGTTTCCTCCTTCTGTTGCTTCTAGCACACTTCCATTTGGGCGAAAGCCAAGTTGAGTTGAATTACTACTCTAAAAGCTGCCCAAAA
GCTGAAGAGATAATCAAGGAACAAGTCACACAACTATACAACAAGCATGGAAACACTGCCGTTTCGTGGGTCAGAAATCTCTTCCACGATTGCGTGGTTAAG
TCATGCGATGCATCACTA
CTGTTAGCGACGGTGAGCGATGTAGTGTCGGAGCAGGCGTCGGATAGAAGTTTTGGGATGAGAAACTTCAAGTACGTAAACACCATCAAAGCAGCGGTTGAGAAAGAATGCCCCTTGACG
GTTTCATGCGCTGACATTGTTGCTCTTTCTGCTAGAGATGGCATTGCCTTG
TTGGGAGGACCAAGCATTGAAATGAAGACAGGGCGAAAGGATAGCAAAGAAAGCTATGCAACGGAGGTG
GAAGCCTTGATTCCAAACCACAATGATTCCATGTCCTCAGTGCTGTCTCGTTTTCAAGCCATTGGCATTGACGTTGAAGCCACAGTCGCTCTTTTAG
GAGCTCACTCGGTTGGAAGAGTT
CACTGCAAGAACCTGGTGCACAGATTATACCCCACCGTGGATTCAACACTAAACCCTGCACACGCTGAGTACCTAAAACGTCGCTGCCCAACACCCAATCCCGATCCAAAAGCTGTTCTG
TATTCTAGGAACGACCTTAAAACGCCCATGATCATTGACAACAACTACTACAAGAACATCTTGCAACACAAGGGTCTTCTAATTGTGGATGAAGAGCTTGCCACTGACCCAATAACTGCA
CCTTATGTCCAAAAGATGGCCAACGACAATGATTATTTCAACCAACAATTCTCAAGGGCCATTCTTTTGTTGTCAGAGACCAATCCTTTAACAGGAGATGAAGGTGAAATCAGAAAGGAT
TGTCGCTACCTCAATGCCAATTAA

Retrieve as FASTA