Entry information : RoKat02
Entry ID 5369
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2007-05-16 (Marcel Zamocky)
Sequence status complete
Reviewer Laure Collomb
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: RoKat02
Name RoKat02
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Mucoraceae Rhizopus
Organism Rhizopus oryzae    [TaxId: 64495 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RoKat02
start..stop
S start..stop
RoKat03 1115 0 11..710 9..710
RoKat04 958 0 8..710 24..718
PblKat02 894 0 20..698 49..728
SpliKat01 662 0 21..690 23..711
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 188475..188668 194 N° 2 188103..188335 233 N° 3 188001..188033 33 N° 4 187744..187942 199
N° 5 187605..187689 85 N° 6 186161..187549 1389  
complement(join(186161..187549,187605..187689,187744..187942,188001..188033,1881 03..188335,188475..188668))


exon

Literature and cross-references RoKat02
Literature unpublished
DNA ref. JGI genome:   supercontig_3.24 (188668..186161)
Protein sequence: RoKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   710
PWM (Da):   %s   79494.03  
PI (pH):   %s   6.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNPTHSSSQPPITNVNTVVDNQGTQETTQFGTKVDTRDSLTAGERGPIIMEDFAFREKITHFGTIPERVVHARGFGVHGYFQPYKDWSELTCAKFLCDPNKKTPVFVRFSTVLGNRGSSDTVRDVRGFATRFYTEEGNFDVGNDVAPFFVQDAIKFVDLIHAAKPEPNKDVPQAATAHNTAYDFFSRQPESIHTVLWALSGRGTPKSLRQVEGFGVHTMRLINEQGKSVFVKFHWKPCQGLNCLEDEAKKINGNDPDFHRNDMYTAIEKGHYPEYEFGVQIIPEEDEDKFEFDLLDSTKIVPESLVPVTPLGKMVLNRNPDDFFGESEQVTFHVAHIVRGIGITDDPLLQGRLFSYTDTQINRMNSANYHQIPINRPITPVHNNNREGFMNFNVHKGAVSYYPNAMQNNKPEPVSPKDGGYIEPPQRVNGIKQRGKHGKKLEYFAQAQLFYNSLTTHEQQLLINNTRFELGKCTDLNVRQNFVTLLNHVDFNLAVRVANGIGVKAPEKPANENKKQTSVGLSIENYKRPNHIKAKTVAIIVAPGIDVNQASDMYKFLSNEGALVDYVGPTVGDFEGLPIKQTFLTSSSVLYDAVFVPNGEADAFYKMLEPCPAFPYGEPIQFIFDTYRHGKPLAVSGNATGLLKAAHVPVYNSKEDQEKYGICTADDLNQLKADFKKAIIIQRFWARIPLDPDAKESPTAASIVIEN*

Retrieve as FASTA  
Remarks Complete from genomic (5 introns). No EST available. Contig position: 188668-186164. Strain="RA 99-880". Fusion of catalase domain with a "catalase related" domain
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAACCCTACTCATTCTAGCTCTCAGCCTCCTATTACAAACGTAAATACCGTAGTTGATAACCAAGGAACTCAGGAAACTACACAGTTTGGTACCAAAGTTGATACACGAGACAGT
TTGACAGCTGGTGAGCGTGGTCCTATCATTATGGAAGACTTTGCGTTTCGAGAAAAGATAACTCATTTTGGTAC
GTAACAAAATAAACTTAGACTTTTGTATGTGTATGTGCACTCATTT
TTATTGTTACTGTATTTTAATAGATCATGAAAGGTAGTTTCACAGTCCCTTTTGCATTATTTGTATAAAATATTAAAAAAGTTGTTATTTTAGAATCCCTGAGCGTGTTGTTCATGCCCG
TGGCTTCGGTGTTCATGGTTACTTTCAACCTTACAAGGATTGGTCTGAATTGACCTGTGCTAAATTCCTCTGTGATCCCAACAAGAAAACACCTGTATTTGTCAGATTCTCTACTGTCCT
GGGTAATAGGGGTTCCTCTGATACTGTTAGAGATGTTCGTGGATTCGCTACTCGATTTTATACAGAAGAAGGAAATTTTGATTTAG
GTAACTGAAAAATTAAATTACGAGAAAAAACAAA
AATGAAGATAACACTTCTTTTTCCTTCACATCTAGTCGGTAATGATGTTGCCCCTTTCTTTGTTCAAGGTAAGATTACGAACATTACTAAGTTTGTTATACCGTGAATTAACGTATATAT
TCGTAGATGCCATCAAATTCGTTGACTTGATTCATGCTGCTAAGCCTGAACCAAACAAGGATGTCCCACAAGCTGCGACTGCTCATAATACAGCATATGACTTCTTTTCTAGACAACCCG
AATCTATCCATACCGTACTTTGGGCTTTGTCGGGAAGAGGCACCCCTAAAAGTCTCCGCCAAGTAGAAGGTTTTGGTGTTCACAC
GTAAGAAAAATAAAAATGATAGGGAAAAGAATATA
ACTAATCATTATTCTTTAGGATGCGTCTTATTAATGAGCAAGGCAAATCTGTATTTGTCAAATTCCATTGGAAGCCATGCCAAGGACTCAACTGTCTTGAATGGGTAATTAAAAAATTTA
TCTAGATGTATCAAAACTAAAGACAGATAATATGTTTAGGACGAGGCAAAGAAGATCAATGGTAATGATCCTGACTTTCATCGTAATGACATGTATACTGCTATTGAGAAAGGGCATTAC
CCTGAATATGAATTTGGTGTACAGATTATTCCTGAAGAAGATGAGGACAAGTTTGAATTTGATCTTTTAGATTCCACCAAAATTGTACCTGAATCACTCGTACCTGTCACTCCATTGGGC
AAGATGGTTTTAAATCGTAACCCTGATGATTTCTTTGGAGAATCAGAACAAGTGACGTTTCATGTGGCTCACATCGTTCGTGGTATTGGAATCACGGATGATCCTCTCTTACAAGGTCGT
TTATTCAGTTATACTGATACTCAAATTAACAGAATGAACAGTGCCAATTATCATCAAATTCCTATTAACCGTCCTATTACTCCTGTTCACAACAATAATCGTGAAGGCTTCATGAATTTC
AATGTTCATAAAGGTGCTGTCTCATATTATCCCAATGCGATGCAAAACAACAAGCCTGAACCTGTTTCTCCCAAAGATGGCGGATACATTGAACCTCCTCAAAGAGTTAATGGTATAAAA
CAGAGAGGCAAACATGGCAAGAAGCTTGAGTATTTCGCTCAGGCCCAGCTTTTCTACAACAGTTTGACGACTCATGAACAGCAATTACTTATTAACAATACTCGCTTCGAGCTTGGTAAA
TGTACAGACCTCAATGTTCGTCAAAACTTTGTAACTCTGTTGAATCACGTTGATTTTAACTTGGCTGTCCGTGTTGCCAACGGCATTGGTGTCAAAGCCCCTGAGAAGCCAGCAAATGAA
AATAAGAAACAGACTAGTGTCGGTCTTTCAATTGAAAACTATAAAAGACCAAATCATATCAAAGCAAAGACTGTAGCCATTATTGTTGCGCCAGGGATCGATGTCAATCAAGCTAGCGAC
ATGTACAAGTTCCTTTCAAATGAAGGTGCTTTGGTAGATTATGTAGGTCCTACTGTTGGAGATTTTGAAGGTTTGCCTATCAAGCAAACTTTTCTTACAAGCAGTTCGGTTTTATATGAC
GCCGTCTTTGTTCCTAATGGTGAAGCTGATGCATTTTATAAAATGTTGGAGCCCTGCCCTGCCTTTCCTTATGGTGAACCAATTCAATTTATCTTTGATACTTATCGCCATGGTAAACCC
TTAGCTGTTTCAGGAAACGCTACTGGTTTACTGAAAGCTGCGCATGTTCCAGTTTACAACAGTAAAGAGGATCAAGAAAAGTATGGCATTTGCACTGCAGATGACTTGAATCAACTCAAG
GCGGACTTCAAAAAGGCCATCATCATTCAGCGATTCTGGGCCCGTATACCACTTGATCCTGATGCTAAAGAATCACCTACCGCCGCCAGTATTGTCATTGAAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAACCCTACTCATTCTAGCTCTCAGCCTCCTATTACAAACGTAAATACCGTAGTTGATAACCAAGGAACTCAGGAAACTACACAGTTTGGTACCAAAGTTGATACACGAGACAGT
TTGACAGCTGGTGAGCGTGGTCCTATCATTATGGAAGACTTTGCGTTTCGAGAAAAGATAACTCATTTTGGTAC
AATCCCTGAGCGTGTTGTTCATGCCCGTGGCTTCGGTGTTCATGGT
TACTTTCAACCTTACAAGGATTGGTCTGAATTGACCTGTGCTAAATTCCTCTGTGATCCCAACAAGAAAACACCTGTATTTGTCAGATTCTCTACTGTCCTGGGTAATAGGGGTTCCTCT
GATACTGTTAGAGATGTTCGTGGATTCGCTACTCGATTTTATACAGAAGAAGGAAATTTTGATTTAG
TCGGTAATGATGTTGCCCCTTTCTTTGTTCAAGATGCCATCAAATTCGTTGAC
TTGATTCATGCTGCTAAGCCTGAACCAAACAAGGATGTCCCACAAGCTGCGACTGCTCATAATACAGCATATGACTTCTTTTCTAGACAACCCGAATCTATCCATACCGTACTTTGGGCT
TTGTCGGGAAGAGGCACCCCTAAAAGTCTCCGCCAAGTAGAAGGTTTTGGTGTTCACAC
GATGCGTCTTATTAATGAGCAAGGCAAATCTGTATTTGTCAAATTCCATTGGAAGCCATGC
CAAGGACTCAACTGTCTTGAATGG
GACGAGGCAAAGAAGATCAATGGTAATGATCCTGACTTTCATCGTAATGACATGTATACTGCTATTGAGAAAGGGCATTACCCTGAATATGAATTT
GGTGTACAGATTATTCCTGAAGAAGATGAGGACAAGTTTGAATTTGATCTTTTAGATTCCACCAAAATTGTACCTGAATCACTCGTACCTGTCACTCCATTGGGCAAGATGGTTTTAAAT
CGTAACCCTGATGATTTCTTTGGAGAATCAGAACAAGTGACGTTTCATGTGGCTCACATCGTTCGTGGTATTGGAATCACGGATGATCCTCTCTTACAAGGTCGTTTATTCAGTTATACT
GATACTCAAATTAACAGAATGAACAGTGCCAATTATCATCAAATTCCTATTAACCGTCCTATTACTCCTGTTCACAACAATAATCGTGAAGGCTTCATGAATTTCAATGTTCATAAAGGT
GCTGTCTCATATTATCCCAATGCGATGCAAAACAACAAGCCTGAACCTGTTTCTCCCAAAGATGGCGGATACATTGAACCTCCTCAAAGAGTTAATGGTATAAAACAGAGAGGCAAACAT
GGCAAGAAGCTTGAGTATTTCGCTCAGGCCCAGCTTTTCTACAACAGTTTGACGACTCATGAACAGCAATTACTTATTAACAATACTCGCTTCGAGCTTGGTAAATGTACAGACCTCAAT
GTTCGTCAAAACTTTGTAACTCTGTTGAATCACGTTGATTTTAACTTGGCTGTCCGTGTTGCCAACGGCATTGGTGTCAAAGCCCCTGAGAAGCCAGCAAATGAAAATAAGAAACAGACT
AGTGTCGGTCTTTCAATTGAAAACTATAAAAGACCAAATCATATCAAAGCAAAGACTGTAGCCATTATTGTTGCGCCAGGGATCGATGTCAATCAAGCTAGCGACATGTACAAGTTCCTT
TCAAATGAAGGTGCTTTGGTAGATTATGTAGGTCCTACTGTTGGAGATTTTGAAGGTTTGCCTATCAAGCAAACTTTTCTTACAAGCAGTTCGGTTTTATATGACGCCGTCTTTGTTCCT
AATGGTGAAGCTGATGCATTTTATAAAATGTTGGAGCCCTGCCCTGCCTTTCCTTATGGTGAACCAATTCAATTTATCTTTGATACTTATCGCCATGGTAAACCCTTAGCTGTTTCAGGA
AACGCTACTGGTTTACTGAAAGCTGCGCATGTTCCAGTTTACAACAGTAAAGAGGATCAAGAAAAGTATGGCATTTGCACTGCAGATGACTTGAATCAACTCAAGGCGGACTTCAAAAAG
GCCATCATCATTCAGCGATTCTGGGCCCGTATACCACTTGATCCTGATGCTAAAGAATCACCTACCGCCGCCAGTATTGTCATTGAAAACTAA

Retrieve as FASTA