Entry information : RoKat03
Entry ID 5370
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2007-05-16 (Marcel Zamocky)
Sequence status complete
Reviewer Laure Collomb
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: RoKat03
Name RoKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Mucoraceae Rhizopus
Organism Rhizopus oryzae    [TaxId: 64495 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RoKat03
start..stop
S start..stop
RoKat02 1138 0 9..710 11..710
RoKat04 940 0 7..710 25..718
PblKat02 871 0 18..698 49..728
CHpiKat01 676 0 17..690 24..720
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2658432..2658615 184 N° 2 2658670..2658679 10 N° 3 2658737..2658969 233 N° 4 2659021..2659053 33
N° 5 2659109..2659307 199 N° 6 2659359..2659443 85 N° 7 2659500..2660888 1389  
join(2658432..2658615,2658670..2658679,2658737..2658969,2659021..2659053,2659109 ..2659307,2659359..2659443,2659500..2660888)


exon

Literature and cross-references RoKat03
Literature unpublished
DNA ref. JGI genome:   supercontig_3.6 (2658432..2660888)
Protein sequence: RoKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   710
PWM (Da):   %s   79964.43  
PI (pH):   %s   6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNIQDKTPPVTNVDTKIDSKGAQETTQFGVKVDSRDSLTAGERGALLMEDFVYREKMTHFDHERIPERVVHARGFGVHGYFQTYKDWSQLTCANFLCHPSKKTPVFVRFSTVLGNRGSPDCVRDVRGFATRFYTDEGNFDVGNVIAPFFVQDPSKFVDLIHAGKPEPDRDIPQAATAHNSTYDFFAQQPETTHTVLWVLSGRGTPKSFRQVEGFGVNTFRLINEQGKWVFVKFHWKPLQGLNNLEDEAQKLNGKDPDFHRNDMYNSIDNGHFPEYELGVQIIPEEDEEKFEFDILDATKIWPESIIPVTILGKMVLNRTPDDFFGETEQVTYHMGHVVRGIGFTDDPLLQGRLFSYIDTQINRMNSVNFHQLPINRPVVPVHNVNREGFMNFNCHKGAVNYFPNTMQGNTPAPAAAKDGGYIEVPQKINGVKQRGKHGKKLEFYSQAQLFYNSLTTAEQQQVVNNFRFELGRCNNFTVRENYVKLLNHVDHNLARRVANGIGVKPPEKPDIENKKQTSVGLSIDNYKRPNHIRGKTVAIVVAPGIDVIQANGMYKFLSDEGAVVDFVGPTPGEVDGMPVVKTFLTSPSVFYDAVFVPTGEVSTFEGLMEPHPAFPYGEPVQFVLDCYRHGKPLAVSGKAVALLKAAHIPLVTSEKDEIKYGLFIAENLDKLKSNFKKGIIIQRFWTRLPIDPDAEESPTPLDIVIED*

Retrieve as FASTA  
Remarks Complete from genomic (6 introns). No EST available. Contig position: 135939-138392. Strain="RA 99-880". Fusion of a catalase domain with "catalase-related" domain. In tandem with RoKat04 .
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAATATTCAAGACAAAACTCCGCCAGTCACTAATGTTGACACAAAGATTGATAGCAAAGGAGCTCAAGAAACAACACAATTCGGAGTCAAGGTGGATTCGCGAGACAGTTTGACC
GCAGGTGAACGTGGTGCTCTCCTTATGGAGGACTTTGTTTACCGTGAAAAGATGACACATTTTG
GTACATAGTTAAAAATGAATGACATGTCGCATATAAACTTATCCTTTTCAATAGAT
CATGAAAG
GTATAGCCTTCAACACGTCTTTTATAAACCAGTAAAACTTTACTAATCTTACTTTAGAATTCCTGAACGTGTCGTACATGCTCGTGGCTTTGGTGTTCATGGTTACTTTCAA
ACTTACAAAGATTGGTCCCAGCTGACTTGTGCCAATTTCCTTTGTCATCCTAGCAAGAAAACACCCGTCTTTGTTCGTTTCTCTACTGTGTTAGGTAACAGAGGTTCTCCTGACTGTGTC
CGAGATGTTCGTGGTTTTGCTACGCGTTTTTACACGGATGAGGGCAACTTTGATTTAG
GTAGTTTTAAAAGATAAACTATAAAACAAAGAAACTTATTCCTTTTTATAGTGGGTAATGTT
ATTGCTCCTTTCTTTGTTCAAG
GTAAGAAATGAATCTGCTTGCTTTATTCTATTTTGTCTAAATGGGACGTGTTTAGATCCCAGTAAATTTGTTGACTTGATTCATGCTGGTAAACCTGA
GCCAGACAGAGATATTCCTCAAGCTGCAACTGCACATAATTCTACTTATGATTTCTTTGCACAGCAACCCGAAACAACTCACACCGTGTTGTGGGTCTTATCTGGTAGAGGAACTCCTAA
AAGTTTCCGTCAAGTCGAAGGCTTTGGTGTTAATAC
GTAAATATGGGCTTATCAAATTTACGCAGTATAATTTAATAATCTAAATAGCTTCCGTCTTATCAACGAACAAGGAAAATGGGT
GTTTGTCAAGTTCCACTGGAAGCCTTTGCAAGGTCTCAATAACCTTGAATGG
GTAAGTGAAATAAAATGGTCTGTTCAACATTTGAACCTAAAACCTGATGCTTACAGGATGAAGCTCAA
AAACTGAATGGCAAAGACCCTGACTTTCACCGTAACGACATGTATAATAGCATTGACAATGGTCATTTCCCTGAATATGAACTTGGTGTACAGATCATTCCTGAAGAAGATGAGGAAAAG
TTTGAATTTGATATATTGGATGCCACCAAGATCTGGCCTGAATCAATTATCCCTGTCACTATTTTGGGTAAAATGGTTTTGAATCGCACGCCAGACGACTTCTTTGGTGAAACCGAACAA
GTGACATACCATATGGGCCACGTTGTTCGCGGCATTGGTTTCACAGATGACCCTCTCTTGCAAGGAAGATTGTTTAGTTATATCGATACACAAATCAACAGGATGAACAGTGTCAATTTC
CATCAACTTCCCATCAACCGTCCCGTGGTGCCTGTTCACAACGTCAACCGTGAAGGTTTCATGAATTTCAACTGCCACAAAGGTGCCGTCAATTACTTTCCAAACACAATGCAAGGCAAC
ACGCCAGCGCCTGCTGCTGCCAAGGACGGAGGCTATATCGAGGTGCCTCAAAAGATCAATGGTGTCAAGCAAAGAGGCAAGCATGGCAAGAAACTCGAATTCTATTCACAAGCCCAATTG
TTCTACAACAGTTTAACCACCGCTGAACAACAACAGGTCGTCAACAACTTTCGTTTTGAACTTGGCCGCTGCAACAACTTTACGGTGCGTGAAAACTATGTAAAGTTGCTCAACCACGTC
GATCACAATCTGGCTCGTCGTGTAGCGAATGGTATTGGCGTCAAGCCCCCTGAGAAGCCTGATATCGAGAACAAGAAACAGACCAGTGTGGGTCTGTCGATTGACAACTACAAGCGTCCG
AATCACATCAGGGGCAAGACGGTGGCTATCGTTGTCGCTCCGGGTATCGATGTGATTCAAGCCAATGGGATGTACAAGTTTCTTTCAGATGAAGGTGCCGTGGTAGACTTCGTCGGTCCT
ACGCCTGGAGAAGTGGATGGCATGCCGGTGGTCAAGACATTTTTGACCAGTCCTTCTGTATTTTATGATGCCGTCTTTGTACCAACGGGTGAAGTGTCTACATTCGAGGGCCTGATGGAA
CCTCATCCCGCTTTCCCTTATGGTGAACCAGTTCAGTTCGTTTTGGATTGTTATCGTCATGGTAAGCCTCTTGCTGTCTCTGGTAAGGCCGTTGCTCTTCTCAAGGCCGCTCACATTCCT
TTGGTTACTTCTGAGAAAGATGAAATTAAATATGGTCTCTTTATTGCTGAAAATCTCGATAAACTCAAGTCAAATTTCAAAAAGGGTATCATCATTCAACGTTTCTGGACTCGTCTACCA
ATCGATCCAGATGCTGAAGAATCACCTACACCTCTTGATATTGTTATTGAAGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAATATTCAAGACAAAACTCCGCCAGTCACTAATGTTGACACAAAGATTGATAGCAAAGGAGCTCAAGAAACAACACAATTCGGAGTCAAGGTGGATTCGCGAGACAGTTTGACC
GCAGGTGAACGTGGTGCTCTCCTTATGGAGGACTTTGTTTACCGTGAAAAGATGACACATTTTG
ATCATGAAAGAATTCCTGAACGTGTCGTACATGCTCGTGGCTTTGGTGTTCATGGT
TACTTTCAAACTTACAAAGATTGGTCCCAGCTGACTTGTGCCAATTTCCTTTGTCATCCTAGCAAGAAAACACCCGTCTTTGTTCGTTTCTCTACTGTGTTAGGTAACAGAGGTTCTCCT
GACTGTGTCCGAGATGTTCGTGGTTTTGCTACGCGTTTTTACACGGATGAGGGCAACTTTGATTTAG
TGGGTAATGTTATTGCTCCTTTCTTTGTTCAAGATCCCAGTAAATTTGTTGAC
TTGATTCATGCTGGTAAACCTGAGCCAGACAGAGATATTCCTCAAGCTGCAACTGCACATAATTCTACTTATGATTTCTTTGCACAGCAACCCGAAACAACTCACACCGTGTTGTGGGTC
TTATCTGGTAGAGGAACTCCTAAAAGTTTCCGTCAAGTCGAAGGCTTTGGTGTTAATAC
CTTCCGTCTTATCAACGAACAAGGAAAATGGGTGTTTGTCAAGTTCCACTGGAAGCCTTTG
CAAGGTCTCAATAACCTTGAATGG
GATGAAGCTCAAAAACTGAATGGCAAAGACCCTGACTTTCACCGTAACGACATGTATAATAGCATTGACAATGGTCATTTCCCTGAATATGAACTT
GGTGTACAGATCATTCCTGAAGAAGATGAGGAAAAGTTTGAATTTGATATATTGGATGCCACCAAGATCTGGCCTGAATCAATTATCCCTGTCACTATTTTGGGTAAAATGGTTTTGAAT
CGCACGCCAGACGACTTCTTTGGTGAAACCGAACAAGTGACATACCATATGGGCCACGTTGTTCGCGGCATTGGTTTCACAGATGACCCTCTCTTGCAAGGAAGATTGTTTAGTTATATC
GATACACAAATCAACAGGATGAACAGTGTCAATTTCCATCAACTTCCCATCAACCGTCCCGTGGTGCCTGTTCACAACGTCAACCGTGAAGGTTTCATGAATTTCAACTGCCACAAAGGT
GCCGTCAATTACTTTCCAAACACAATGCAAGGCAACACGCCAGCGCCTGCTGCTGCCAAGGACGGAGGCTATATCGAGGTGCCTCAAAAGATCAATGGTGTCAAGCAAAGAGGCAAGCAT
GGCAAGAAACTCGAATTCTATTCACAAGCCCAATTGTTCTACAACAGTTTAACCACCGCTGAACAACAACAGGTCGTCAACAACTTTCGTTTTGAACTTGGCCGCTGCAACAACTTTACG
GTGCGTGAAAACTATGTAAAGTTGCTCAACCACGTCGATCACAATCTGGCTCGTCGTGTAGCGAATGGTATTGGCGTCAAGCCCCCTGAGAAGCCTGATATCGAGAACAAGAAACAGACC
AGTGTGGGTCTGTCGATTGACAACTACAAGCGTCCGAATCACATCAGGGGCAAGACGGTGGCTATCGTTGTCGCTCCGGGTATCGATGTGATTCAAGCCAATGGGATGTACAAGTTTCTT
TCAGATGAAGGTGCCGTGGTAGACTTCGTCGGTCCTACGCCTGGAGAAGTGGATGGCATGCCGGTGGTCAAGACATTTTTGACCAGTCCTTCTGTATTTTATGATGCCGTCTTTGTACCA
ACGGGTGAAGTGTCTACATTCGAGGGCCTGATGGAACCTCATCCCGCTTTCCCTTATGGTGAACCAGTTCAGTTCGTTTTGGATTGTTATCGTCATGGTAAGCCTCTTGCTGTCTCTGGT
AAGGCCGTTGCTCTTCTCAAGGCCGCTCACATTCCTTTGGTTACTTCTGAGAAAGATGAAATTAAATATGGTCTCTTTATTGCTGAAAATCTCGATAAACTCAAGTCAAATTTCAAAAAG
GGTATCATCATTCAACGTTTCTGGACTCGTCTACCAATCGATCCAGATGCTGAAGAATCACCTACACCTCTTGATATTGTTATTGAAGACTAA

Retrieve as FASTA