Entry information : RoKat04
Entry ID 5371
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2007-05-16 (Marcel Zamocky)
Sequence status complete
Reviewer Laure Collomb
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: RoKat04
Name RoKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Mucoraceae Rhizopus
Organism Rhizopus oryzae    [TaxId: 64495 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RoKat04
start..stop
S start..stop
RoKat02 958 0 24..718 8..710
PblKat02 953 0 36..706 49..728
RoKat03 920 0 25..718 7..710
SpliKat01 678 0 27..698 12..711
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2661403..2661640 238 N° 2 2661727..2661736 10 N° 3 2661794..2662026 233 N° 4 2662189..2662387 199
N° 5 2662443..2662527 85 N° 6 2662580..2662862 283 N° 7 2662910..2664018 1109  
join(2661403..2661640,2661727..2661736,2661794..2662026,2662189..2662387,2662443 ..2662527,2662580..2662862,2662910..2664018)


exon

Literature and cross-references RoKat04
Literature unpublished
DNA ref. JGI genome:   supercontig_3.6 (2661403..2664018)
Protein sequence: RoKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   718 (698)
PWM (Da):   %s   81066.57 (78888.4)  
PI (pH):   %s   5.85 (5.67) Peptide Signal:   %s   cut: 21 range:21-718
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKKPTAIFLFIMLGCQLVSGSSDSRTAPVTDIDADVYDAGTQETTQFGVKINNTDSLTAGDRGPTLLEDFMMREKVMHFDHERIPERAVHARGVAVHGYFQSYEDWSNITAAKFLQDPDTKTPVFVRFSTVLGSRGSPDTVRDVRGFATRFYTEEGNWDDAIKFPDLIHAAKPEPDKEVPQAGTAHSTAYDFFSQHTETIHTVMWALSGRGTPRSFRQVEGFGVHTFRFINEDRKTVLVKFHWKPLQGLSNLVWDEAQKIAGKDIDFHRNDLYTAIENGDYPEYELGVQIVSEEDQDKFDFDLLDATKIIPESLVPVTKLGKMVLNRNPDNYFSETEQVTFHPGHIVGITFTDDPLLQGRLFSYTDTQLNRMHSANYLQLPINRPLVPVHNNQRDGFMQFNVYHGRVAYYPNALQDNTPSVVSEEEGGYLEYPENIRGRKQRGKHGKFADHFSQAQLFYNSLTTHEQQQLVNNFRFEVGKCDSKLVRQNFVDVLNRVDNNLARRVARGVGVEEPSPVSENEGETTINLSIENYKRPDHIRAKKVAILTGPGIDDSQVKEMKDYLTGENAYVDLVGLNLDEDNSEGLNITQTYSTTSSVLYDAVYVPSGEKRTFEILTSPRPEFPYDEPLMFVLDAYRHGKPIAVSGRGLELLKSAKVPTFNGTDAAANHGIYISSDVSNLASDFRKGIIIQRFWNRMALDHDAKKSPTSSHIKIED

Retrieve as FASTA  
Remarks Complete from genomic (6 introns). No EST avaible. Contig position: 138910-141522. Strain="RA 99-880". Fusion of a catalase domain with catalase-related domain. In tandem with RoKat03.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAAGCCTACTGCAATCTTCTTATTCATTATGCTTGGTTGCCAACTTGTCTCTGGCTCTAGCGATAGTCGAACCGCCCCGGTGACAGACATTGATGCTGATGTTTATGACGCGGGA
ACTCAGGAAACAACGCAATTTGGCGTAAAGATAAACAATACAGACTCTTTGACTGCTGGCGATCGAGGACCTACTCTTTTGGAAGATTTTATGATGCGTGAAAAAGTCATGCACTTTG
GT
AAAAAAGAATAATAATAATAAAAAACGATTGCTTTCTTGTCGTGCTAACGAAATACCTTGTCCTTTCTATTACGATCATCATAGATCATGAAAGGTAACAAGAAAATCAGACAAACACTA
TTTCTTGTACTCATTCTTTTTTTCCTTGTAGAATACCTGAACGCGCTGTTCATGCCCGTGGTGTTGCTGTTCATGGTTACTTTCAGTCTTATGAAGACTGGTCAAATATCACTGCCGCCA
AGTTTCTCCAAGATCCTGATACCAAAACACCCGTCTTTGTTCGCTTCTCTACCGTCCTTGGTTCTCGTGGGTCTCCAGATACCGTTCGGGACGTTCGAGGCTTCGCTACTCGATTTTACA
CAGAAGAAGGAAACTGGGATCTGG
GTAACGTTTCACATACTCCGAAATCTCGATGTCTGTGTTAATTTTTTTTTTTTTTTTCCTTTCGTCATCTAGTTGCTAATAACATTGCACCATTCT
TCATTCAAGGCAAGTTGGGATAGACTGTGTGAAAAAAAAAAGTAGACTAAAGATAGCTCCGTTTAGATGCCATCAAGTTTCCCGATTTGATTCATGCTGCTAAACCTGAGCCTGACAAGG
AAGTTCCTCAGGCAGGAACTGCTCACAGTACTGCTTATGATTTCTTTTCTCAACATACCGAGACCATCCACACCGTGATGTGGGCCTTATCGGGTAGGGGTACACCAAGAAGTTTCCGTC
AAGTAGAAGGTTTTGGTGTTCATAC
GTAAGTGTCAAGCTGTTGACCCTCTCGTAGCTCATGACTGATTTTTCTTGAACAGCTTCCGTTTCATTAACGAAGATCGCAAGACTGTACTTGTC
AAATTTCACTGGAAGCCTTTACAAGGCCTTTCAAACTTAGTCTGG
GTAAGCATTAAAAAAACCAGGATGGATTGATTCTAATTTTTTTTTCATGTAGGACGAAGCTCAAAAGATTGCTGG
TAAAGACATTGACTTTCACCGCAACGATTTGTATACTGCTATTGAAAATGGTGATTACCCTGAATATGAACTTGGTGTGCAAATAGTTTCTGAAGAAGATCAAGACAAGTTTGATTTTGA
TCTTTTGGATGCTACCAAGATTATTCCCGAATCCCTTGTGCCTGTGACAAAGTTGGGTAAAATGGTCTTGAACCGTAACCCTGACAATTACTTTTCGGAAACCGAACAGGTCACTTTCCA
CCCGGGTCACATTGTTCGCG
GTAGGTGGATGAGGAGGAAGAGGTACTGAAACTAAACTTTTCTTTAGGTATCACCTTTACCGATGACCCTCTTTTACAAGGCCGTCTGTTCAGCTACACT
GACACCCAATTGAACCGTATGCACAGTGCCAACTATCTCCAGCTGCCTATCAACCGTCCCTTGGTCCCTGTTCACAACAACCAGCGGGATGGATTCATGCAGTTCAATGTCTATCATGGC
AGAGTCGCTTACTATCCCAACGCCTTGCAAGACAACACACCTTCGGTCGTCAGTGAGGAAGAGGGAGGTTACCTTGAATATCCCGAAAACATCCGAGGCAGGAAGCAACGCGGCAAGCAT
GGGAAATTCGCTGACCACTTTTCTCAAGCTCAATTGTTTTACAACAGCTTGACGACCCATGAACAGCAGCAGCTCGTCAACAACTTCCGCTTTGAGGTTGGCAAGTGTGACAGCAAGCTC
GTCCGTCAAAACTTTGTGGATGTTTTGAATCGGGTCGATAACAACCTGGCGCGTCGTGTCGCTAGAGGGGTTGGTGTCGAAGAGCCTTCTCCGGTGAGCGAGAATGAGGGTGAGACGACC
ATTAACTTGTCTATCGAAAATTACAAACGCCCCGATCACATCCGGGCCAAGAAGGTTGCCATCTTGACCGGCCCTGGTATTGATGATTCTCAAGTCAAGGAAATGAAGGACTACCTTACG
GGTGAAAACGCCTATGTTGATCTGGTGGGTCTCAACCTCGACGAGGATAATTCAGAGGGTCTCAACATAACCCAGACTTACTCTACCACTTCCTCTGTCCTTTACGATGCTGTCTATGTT
CCTTCGGGAGAAAAGCGTACATTTGAAATCTTGACCAGTCCTCGTCCCGAATTCCCCTACGATGAACCTCTTATGTTTGTCTTGGACGCTTATCGTCATGGTAAACCTATCGCTGTCTCT
GGTAGAGGTCTTGAGCTTCTCAAGTCTGCCAAGGTACCTACCTTTAATGGTACTGATGCTGCTGCTAACCATGGCATTTATATCTCCTCTGATGTCTCTAACTTGGCTTCTGATTTCAGA
AAGGGTATCATCATCCAACGTTTCTGGAATCGTATGGCTCTTGATCATGATGCCAAAAAGTCTCCTACTTCTTCACATATCAAAATTGAAGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAAGCCTACTGCAATCTTCTTATTCATTATGCTTGGTTGCCAACTTGTCTCTGGCTCTAGCGATAGTCGAACCGCCCCGGTGACAGACATTGATGCTGATGTTTATGACGCGGGA
ACTCAGGAAACAACGCAATTTGGCGTAAAGATAAACAATACAGACTCTTTGACTGCTGGCGATCGAGGACCTACTCTTTTGGAAGATTTTATGATGCGTGAAAAAGTCATGCACTTTG
AT
CATGAAAG
AATACCTGAACGCGCTGTTCATGCCCGTGGTGTTGCTGTTCATGGTTACTTTCAGTCTTATGAAGACTGGTCAAATATCACTGCCGCCAAGTTTCTCCAAGATCCTGATACC
AAAACACCCGTCTTTGTTCGCTTCTCTACCGTCCTTGGTTCTCGTGGGTCTCCAGATACCGTTCGGGACGTTCGAGGCTTCGCTACTCGATTTTACACAGAAGAAGGAAACTGGGATCTG
G
ATGCCATCAAGTTTCCCGATTTGATTCATGCTGCTAAACCTGAGCCTGACAAGGAAGTTCCTCAGGCAGGAACTGCTCACAGTACTGCTTATGATTTCTTTTCTCAACATACCGAGACC
ATCCACACCGTGATGTGGGCCTTATCGGGTAGGGGTACACCAAGAAGTTTCCGTCAAGTAGAAGGTTTTGGTGTTCATAC
CTTCCGTTTCATTAACGAAGATCGCAAGACTGTACTTGTC
AAATTTCACTGGAAGCCTTTACAAGGCCTTTCAAACTTAGTCTGG
GACGAAGCTCAAAAGATTGCTGGTAAAGACATTGACTTTCACCGCAACGATTTGTATACTGCTATTGAAAATGGT
GATTACCCTGAATATGAACTTGGTGTGCAAATAGTTTCTGAAGAAGATCAAGACAAGTTTGATTTTGATCTTTTGGATGCTACCAAGATTATTCCCGAATCCCTTGTGCCTGTGACAAAG
TTGGGTAAAATGGTCTTGAACCGTAACCCTGACAATTACTTTTCGGAAACCGAACAGGTCACTTTCCACCCGGGTCACATTGTTCGCG
GTATCACCTTTACCGATGACCCTCTTTTACAA
GGCCGTCTGTTCAGCTACACTGACACCCAATTGAACCGTATGCACAGTGCCAACTATCTCCAGCTGCCTATCAACCGTCCCTTGGTCCCTGTTCACAACAACCAGCGGGATGGATTCATG
CAGTTCAATGTCTATCATGGCAGAGTCGCTTACTATCCCAACGCCTTGCAAGACAACACACCTTCGGTCGTCAGTGAGGAAGAGGGAGGTTACCTTGAATATCCCGAAAACATCCGAGGC
AGGAAGCAACGCGGCAAGCATGGGAAATTCGCTGACCACTTTTCTCAAGCTCAATTGTTTTACAACAGCTTGACGACCCATGAACAGCAGCAGCTCGTCAACAACTTCCGCTTTGAGGTT
GGCAAGTGTGACAGCAAGCTCGTCCGTCAAAACTTTGTGGATGTTTTGAATCGGGTCGATAACAACCTGGCGCGTCGTGTCGCTAGAGGGGTTGGTGTCGAAGAGCCTTCTCCGGTGAGC
GAGAATGAGGGTGAGACGACCATTAACTTGTCTATCGAAAATTACAAACGCCCCGATCACATCCGGGCCAAGAAGGTTGCCATCTTGACCGGCCCTGGTATTGATGATTCTCAAGTCAAG
GAAATGAAGGACTACCTTACGGGTGAAAACGCCTATGTTGATCTGGTGGGTCTCAACCTCGACGAGGATAATTCAGAGGGTCTCAACATAACCCAGACTTACTCTACCACTTCCTCTGTC
CTTTACGATGCTGTCTATGTTCCTTCGGGAGAAAAGCGTACATTTGAAATCTTGACCAGTCCTCGTCCCGAATTCCCCTACGATGAACCTCTTATGTTTGTCTTGGACGCTTATCGTCAT
GGTAAACCTATCGCTGTCTCTGGTAGAGGTCTTGAGCTTCTCAAGTCTGCCAAGGTACCTACCTTTAATGGTACTGATGCTGCTGCTAACCATGGCATTTATATCTCCTCTGATGTCTCT
AACTTGGCTTCTGATTTCAGAAAGGGTATCATCATCCAACGTTTCTGGAATCGTATGGCTCTTGATCATGATGCCAAAAAGTCTCCTACTTCTTCACATATCAAAATTGAAGATTAA

Retrieve as FASTA