Entry information : PnoKat01
Entry ID 5389
Creation 2007-05-18 (Christophe Dunand)
Last sequence changes 2007-05-18 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoKat01
Name PnoKat01
Class Catalase    [Orthogroup: Kat002]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoKat01
start..stop
S start..stop
CheKat01_C5 967 0 1..546 1..546
CheKat01_C4 967 0 1..546 1..546
CtheKat3 899 0 1..546 37..582
CcinKat03 822 0 3..532 26..561
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1378278..1378402 125 N° 2 1378453..1378618 166 N° 3 1378666..1378830 165 N° 4 1378876..1379874 999
N° 5 1379950..1380135 186  
join(1378278..1378402,1378453..1378618,1378666..1378830,1378876..1379874,1379950 ..1380135)


exon

Literature and cross-references PnoKat01
Literature Lander,E. and Birren,B. The Genome Sequencing Platform, The Genome Assembly Team. Direct Submission
Protein ref. GenPept:   EAT89953 UniProtKB_Uniparc:   Q0UYE2
DNA ref. JGI genome:   scaffold_4 (1378278..1380135)
Protein sequence: PnoKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   546
PWM (Da):   %s   62120.3  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSANEGPADIIAKVSGAVQGGKREDDGPYFTNNEGIPYPDPAHSKNIGGIPVASDVFLFQKQQTFNRSKNLERMVHPCGSGAFGYFETTKDVSNLKANFLGSVGEKTPIFVRFSTVTVGREYPDLARNPRGFAIKFYTQEGNYDIVGLNFPVFFCRDPLQGPDVIRSQARNPRNFLPDYDALFDLLANTPEGNHAGLMFFSDHGTPKGWRYEHGYGCHTFKWVNAEGKFVYIKYHFIAKHGQKQFTQEEATRMCGEDPDYSKRDLWEAIEKGEEIEWTAMVQVMEPQDADPEKLGFDPFDVTKVWPRSQFPMHEFGRLVLNKNPENFHRDVEQAAFSPGSMVPGIEDSPDPLLQFRMFFYRDAQYHRIGVNLHQVPVNCPFMAKQFATLNFDGQMRVDANHAGNKQYAPNSFAHKFRPDVAEAPYVVSDNVVSRKSHYYHEGKKSDYAQATELWSRVMTEQQRKNTIKNTGNMLKFVGYPEIQVYNVGTDYAQGIYDMLPSPEFQFAEVEKLAETAQEWYKEKKFQPSTENKLRGDAPIAPWYN*

Retrieve as FASTA  
Remarks Complete sequenc from genomic (4 introns), no EST. Contig position: 14456-16310. Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGTGCGAACGAAGGTCCTGCCGATATCATCGCAAAGGTTTCTGGAGCTGTTCAAGGTGGGAAGCGTGAGGACGATGGCCCGTACTTCACCAACAATGAGGGCATTCCCTATCCC
GACCC
GTAAGTGATACCTACCACTTAGCTCCTCAACCATACTGACGGCTTCGTAGAGCACACAGCAAGAACATCGGTGGTATCCCAGTAGCGAGCGATGTGTTCCTATTCCAGAAGCAGC
AGACTTTCAACCGATCGAAGAACCTCGAGCGCATGGTGCATCCTTGTGGCTCTGGGGCTTTCGGATATTTCGAGACCACAAAGGACGTGTCGAACCTCACC
GTATGCCATCACACACTCT
CCAAAATTGAAGTACTGATTGAGCGTAGAAAGCCAACTTCCTCGGCAGTGTCGGCGAGAAGACACCAATCTTTGTCCGCTTCTCTACTGTCACCGTCGGTCGTGAGTATCCTGACTTGGC
TCGCAATCCCCGTGGCTTTGCCATCAAGTTCTACACCCAGGAGGGCAATTATGACATTGTTGGCTTGAACTTT
GTAAGCTAATCATCTACCAAAAGAGACTGGAACTAACAAACCCAGCC
AGTCTTTTTTTGTCGTGATCCCCTTCAGGGACCCGACGTTATTCGCTCTCAAGCCCGCAACCCGCGCAACTTCCTCCCGGACTACGATGCACTGTTCGACCTACTTGCAAACACCCCCGA
AGGTAACCATGCTGGTCTCATGTTCTTCAGTGACCATGGCACTCCGAAAGGATGGCGTTACGAGCATGGTTACGGCTGCCACACCTTCAAGTGGGTCAATGCCGAGGGCAAATTTGTGTA
CATCAAGTACCACTTCATTGCCAAACATGGCCAGAAGCAGTTTACACAAGAAGAAGCTACACGCATGTGCGGAGAAGACCCCGATTACTCCAAGCGCGACCTCTGGGAAGCGATTGAAAA
GGGCGAGGAAATTGAGTGGACTGCCATGGTTCAGGTAATGGAACCTCAAGATGCTGACCCGGAGAAGCTTGGTTTCGACCCATTCGATGTGACCAAAGTCTGGCCACGAAGCCAGTTTCC
CATGCATGAGTTTGGCCGTCTTGTGCTCAATAAGAACCCTGAGAACTTTCACCGCGATGTCGAGCAGGCAGCCTTCTCGCCCGGTAGCATGGTCCCCGGCATCGAAGACTCACCCGACCC
ACTCCTCCAGTTCCGCATGTTCTTCTACCGCGACGCGCAATACCATCGCATCGGTGTCAATCTCCATCAAGTGCCCGTAAACTGCCCGTTCATGGCGAAGCAGTTTGCAACTCTCAACTT
CGATGGGCAGATGCGTGTGGACGCCAATCATGCCGGTAACAAGCAGTATGCGCCTAATAGCTTCGCGCACAAGTTCCGACCGGACGTTGCTGAGGCGCCATACGTAGTCAGCGATAACGT
GGTCAGTCGCAAGAGCCACTATTACCACGAGGGCAAGAAATCGGACTATGCGCAAGCGACTGAACTGTGGAGTCGCGTCATGACGGAGCAGCAGCGCAAGAACACGATCAAGAACACGGG
AAATATGCTCAAATTTGTGGGATATCCCGAAATTCAG
GTGAGTTGATGGTGCAGCTTGCATGCCATGAATTGGCACACGCTAACAGCCCTGCAGAAGAAATACCTTGCTCAGGTCTACAA
TGTTGGCACCGACTATGCACAAGGCATTTACGATATGCTCCCCAGTCCCGAATTTCAATTCGCTGAAGTCGAGAAGTTGGCAGAGACGGCGCAGGAGTGGTACAAAGAGAAGAAGTTCCA
GCCATCGACTGAGAATAAGTTGAGGGGTGATGCGCCTATTGCACCTTGGTATAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGTGCGAACGAAGGTCCTGCCGATATCATCGCAAAGGTTTCTGGAGCTGTTCAAGGTGGGAAGCGTGAGGACGATGGCCCGTACTTCACCAACAATGAGGGCATTCCCTATCCC
GACCC
AGCACACAGCAAGAACATCGGTGGTATCCCAGTAGCGAGCGATGTGTTCCTATTCCAGAAGCAGCAGACTTTCAACCGATCGAAGAACCTCGAGCGCATGGTGCATCCTTGTGGC
TCTGGGGCTTTCGGATATTTCGAGACCACAAAGGACGTGTCGAACCTCACC
AAAGCCAACTTCCTCGGCAGTGTCGGCGAGAAGACACCAATCTTTGTCCGCTTCTCTACTGTCACCGTC
GGTCGTGAGTATCCTGACTTGGCTCGCAATCCCCGTGGCTTTGCCATCAAGTTCTACACCCAGGAGGGCAATTATGACATTGTTGGCTTGAACTTT
CCAGTCTTTTTTTGTCGTGATCCC
CTTCAGGGACCCGACGTTATTCGCTCTCAAGCCCGCAACCCGCGCAACTTCCTCCCGGACTACGATGCACTGTTCGACCTACTTGCAAACACCCCCGAAGGTAACCATGCTGGTCTCATG
TTCTTCAGTGACCATGGCACTCCGAAAGGATGGCGTTACGAGCATGGTTACGGCTGCCACACCTTCAAGTGGGTCAATGCCGAGGGCAAATTTGTGTACATCAAGTACCACTTCATTGCC
AAACATGGCCAGAAGCAGTTTACACAAGAAGAAGCTACACGCATGTGCGGAGAAGACCCCGATTACTCCAAGCGCGACCTCTGGGAAGCGATTGAAAAGGGCGAGGAAATTGAGTGGACT
GCCATGGTTCAGGTAATGGAACCTCAAGATGCTGACCCGGAGAAGCTTGGTTTCGACCCATTCGATGTGACCAAAGTCTGGCCACGAAGCCAGTTTCCCATGCATGAGTTTGGCCGTCTT
GTGCTCAATAAGAACCCTGAGAACTTTCACCGCGATGTCGAGCAGGCAGCCTTCTCGCCCGGTAGCATGGTCCCCGGCATCGAAGACTCACCCGACCCACTCCTCCAGTTCCGCATGTTC
TTCTACCGCGACGCGCAATACCATCGCATCGGTGTCAATCTCCATCAAGTGCCCGTAAACTGCCCGTTCATGGCGAAGCAGTTTGCAACTCTCAACTTCGATGGGCAGATGCGTGTGGAC
GCCAATCATGCCGGTAACAAGCAGTATGCGCCTAATAGCTTCGCGCACAAGTTCCGACCGGACGTTGCTGAGGCGCCATACGTAGTCAGCGATAACGTGGTCAGTCGCAAGAGCCACTAT
TACCACGAGGGCAAGAAATCGGACTATGCGCAAGCGACTGAACTGTGGAGTCGCGTCATGACGGAGCAGCAGCGCAAGAACACGATCAAGAACACGGGAAATATGCTCAAATTTGTGGGA
TATCCCGAAATTCAG
GTCTACAATGTTGGCACCGACTATGCACAAGGCATTTACGATATGCTCCCCAGTCCCGAATTTCAATTCGCTGAAGTCGAGAAGTTGGCAGAGACGGCGCAGGAG
TGGTACAAAGAGAAGAAGTTCCAGCCATCGACTGAGAATAAGTTGAGGGGTGATGCGCCTATTGCACCTTGGTATAACTAG

Retrieve as FASTA