Entry information : PnoKat03
Entry ID 5391
Creation 2007-05-18 (Christophe Dunand)
Last sequence changes 2007-05-18 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoKat03
Name PnoKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoKat03
start..stop
S start..stop
CheKat03_C5 1105 0 3..720 5..725
CheKat03_C4 1105 0 3..720 5..725
AnKat02 934 0 6..724 4..726
PEchKat03 929 0 11..720 10..725
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1270949..1271225 277 N° 2 1271275..1271511 237 N° 3 1271571..1271986 416 N° 4 1272037..1272201 165
N° 5 1272251..1272391 141 N° 6 1272414..1273336 923 N° 7 1273413..1273467 55  
join(1270949..1271225,1271275..1271511,1271571..1271986,1272037..1272201,1272251 ..1272391,1272414..1273336,1273413..1273467)


exon

Literature and cross-references PnoKat03
Literature Lander,E. and Birren,B. The Genome Sequencing Platform, The Genome Assembly Team. Direct Submission
Protein ref. GenPept:   EAT89904 UniProtKB:   Q0UYJ1
DNA ref. JGI genome:   scaffold_4 (1270949..1273467)
Protein sequence: PnoKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   737 (720)
PWM (Da):   %s   81332.39 (79596.5)  
PI (pH):   %s   5.42 (5.32) Peptide Signal:   %s   cut: 18 range:18-737
Sequence 778
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVNFRVTFLACAGLAAASCPYMENEAPIKRDGAAQSPKSTDEFMAQYEVDDKDVYLTNGFGGPVEDMESLSAGERGPTLLEDFIFREKIMHFDHERVPERAVHARGAGAHGVFTSYADWSNITGASFLNKPSKETPVFIRFSTVAGSRGSPDSVRDVRGFAVRFYTDEGNFDIVGNNIPVFFIQDAIKFPDLIHAVKPRQDNEIPQAATAHDSAWDFFSQQPSSMHTLFWAMSGHGTVRSYRHMDGWGVHTFRLVTDEGKTKLVKFRFRTQQGLASRLWEEQQHAAGMNADTDRQDLWDAIENGYYPEWIFEAQIMDEEDQLRFGFDLLDPTKIVPEDLVPFTPLGKLTLNRNPRNYFAETEQVMFQVGHIVRGIDFTEDPLMQGRIFSYLDTQLNRHGGPNFEQLPINQPRRDGAGQMYIPLNNAPYSPNTLNAGSPKPANQTQGRGFFSAPNRSTGGRLVRAVSSTFADVWSQPRLFFNSLLPVEQQMVINAMRFETAQLTSEVVKNNVLIQLNRVSHDIAVRVAEALDMTAPAADDTYYHDNKTTGISVAEKKLLKLDGLKVGYLSSVSSNGDTAAALKTALNDLKVRFSVVGERLGKGIDQTYSATFAGQFDAIVVDGQAEALFMPAGSLANSNTTANATKAYTTLYPAGRPLSILQTGYQWGKAVGVIGSSSAAFSAAGLQAGTPGVYHFEAGNSTKAIVDQLAEGLRTFRFLDRQLDEREFVCGVTDFQDA

Retrieve as FASTA  
Remarks Complete sequenc from genomic (6 introns), no EST. Contig position: 144480-146995. Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTCAATTTTAGGGTAACTTTCCTTGCCTGCGCGGGTCTTGCCGCCGCATCATGTCCGTACATGGAGAACGAGGCTCCCATCAAACGAGATGGTGCTGCTCAGTCTCCCAAGTCCACAG
ACGAGTTCATGGCGCAATATGAGGTCGATGATAAAGACGTTTACCTGACGAACGGTTTCGGCGGTCCCGTCGAAGACATGGAGAGTTTGAGTGCTGGCGAGAGAGGCCCTACTCTGCTCG
AGGACTTCATCTTCAGGGAAAAGATCATGCACTTTG
GTATGTACACTTGTCGCCAGTAAGATTTCAGTTCTAACACCTAACACAGATCACGAGAGAGTACCTGAAAGGGCTGTCCATGCC
AGAGGCGCAGGAGCGCACGGAGTTTTCACTTCTTACGCAGACTGGTCGAACATCACAGGTGCTTCATTCTTGAACAAGCCAAGCAAGGAGACGCCGGTCTTCATCCGATTCTCCACCGTT
GCCGGCAGTCGTGGATCACCTGACAGTGTCCGCGATGTGCGTGGATTCGCGGTTCGTTTCTACACCGACGAGGGCAACTTTG
GTATGTCGTTCAGAATTCTGTAGGAGTTCAACGGTTCA
CAGCAGTGCTAACGTTTCCAGATATTGTTGGAAACAACATCCCCGTCTTCTTCATTCAGGATGCCATCAAGTTCCCAGACCTGATTCACGCCGTCAAGCCAAGACAGGATAACGAGATTC
CCCAGGCAGCCACCGCTCACGACAGCGCATGGGACTTCTTCAGCCAGCAGCCATCTTCAATGCACACGCTCTTCTGGGCCATGAGCGGCCATGGAACCGTCCGCTCATACCGACACATGG
ACGGCTGGGGCGTCCACACGTTCCGTCTGGTCACCGACGAAGGCAAGACCAAGTTGGTCAAGTTCCGTTTCAGAACCCAGCAGGGTCTTGCGTCACGACTATGGGAAGAGCAGCAGCATG
CTGCTGGTATGAACGCAGATACCGATAGACAGGATCTGTGGGACGCTATTGAGAATGGCTACTACCCAGAGTGGATC
GTAAGTCTTGCGTTGCATTTGTACACGCGCTTTGCTGATCATG
ATGATAGTTTGAGGCGCAAATCATGGATGAGGAGGATCAATTACGATTTGGCTTCGACCTCCTCGACCCTACCAAGATTGTGCCCGAGGATCTTGTTCCTTTCACACCATTAGGCAAGCT
GACCTTGAACCGCAACCCTCGCAACTACTTCGCGGAAACTGAGCAAGTCATG
GTAAGTCAAACTTGACGTTTTTGTCTGCAATCGACTAACGATGACGCAGTTCCAAGTGGGCCACATTG
TGCGTGGTATTGATTTCACCGAGGACCCTCTCATGCAAGGCCGCATCTTCTCCTACCTAGACACCCAGCTCAACCGCCACGGAGGACCAAACTTTGAACAGCTACCAATCAACCAACCCC
GC
GTTCCAGTACCACACCAACCAGCGCGATGGTGCCGGACAAATGTACATTCCCCTTAACAACGCACCCTACTCGCCAAACACCTTGAACGCCGGCTCCCCAAAGCCGGCAAACCAGACT
CAGGGTCGTGGCTTCTTCTCCGCTCCAAACCGTTCCACTGGCGGTCGTCTTGTCCGCGCTGTATCTTCTACTTTTGCCGATGTTTGGTCTCAGCCGCGTCTGTTCTTCAACTCGCTACTG
CCAGTTGAGCAACAGATGGTCATTAACGCAATGCGCTTCGAGACGGCTCAACTCACGAGCGAAGTAGTTAAGAACAATGTGTTGATCCAGCTCAACCGCGTGAGTCACGATATTGCTGTA
CGCGTCGCTGAAGCACTGGACATGACTGCACCAGCAGCAGATGATACCTACTACCACGACAACAAGACGACTGGAATCAGCGTTGCAGAGAAGAAGTTGTTGAAGCTGGATGGTCTGAAG
GTCGGATACCTGAGTTCCGTATCCTCGAATGGCGACACCGCAGCTGCGCTCAAGACTGCGCTTAACGACCTCAAGGTCAGATTTTCTGTAGTAGGCGAGCGTCTTGGGAAGGGCATTGAC
CAGACCTACTCCGCTACATTCGCAGGTCAATTTGATGCCATCGTCGTCGACGGCCAGGCAGAGGCTCTCTTCATGCCTGCTGGAAGTCTGGCAAATTCAAACACCACAGCGAACGCTACC
AAGGCATACACGACTCTCTACCCCGCTGGTCGACCCCTGTCGATCTTGCAGACTGGCTACCAATGGGGCAAAGCCGTTGGCGTAATTGGCTCAAGCAGTGCAGCCTTTAGTGCCGCAGGC
CTCCAGGCTGGCACCCCCGGTGTCTACCACTTCGAAGCAGGAAACAGTACAAAGGCGATCGTGGACCAGCTCGCTGAGGGTCTACGCACTTTCCGATTCTTGGACAG
GTATGCGCTAGAC
CAGTAGAGTGTGAGATGTGAATGGTGGCAGAGGTGAAGAAAGACAATTCATACATTTCTCTAGACAACTTGATGAGCGTGAATTTGTTTGCGGTGTTACGGACTTTCAAGACGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTCAATTTTAGGGTAACTTTCCTTGCCTGCGCGGGTCTTGCCGCCGCATCATGTCCGTACATGGAGAACGAGGCTCCCATCAAACGAGATGGTGCTGCTCAGTCTCCCAAGTCCACAG
ACGAGTTCATGGCGCAATATGAGGTCGATGATAAAGACGTTTACCTGACGAACGGTTTCGGCGGTCCCGTCGAAGACATGGAGAGTTTGAGTGCTGGCGAGAGAGGCCCTACTCTGCTCG
AGGACTTCATCTTCAGGGAAAAGATCATGCACTTTG
ATCACGAGAGAGTACCTGAAAGGGCTGTCCATGCCAGAGGCGCAGGAGCGCACGGAGTTTTCACTTCTTACGCAGACTGGTCGA
ACATCACAGGTGCTTCATTCTTGAACAAGCCAAGCAAGGAGACGCCGGTCTTCATCCGATTCTCCACCGTTGCCGGCAGTCGTGGATCACCTGACAGTGTCCGCGATGTGCGTGGATTCG
CGGTTCGTTTCTACACCGACGAGGGCAACTTTG
ATATTGTTGGAAACAACATCCCCGTCTTCTTCATTCAGGATGCCATCAAGTTCCCAGACCTGATTCACGCCGTCAAGCCAAGACAGG
ATAACGAGATTCCCCAGGCAGCCACCGCTCACGACAGCGCATGGGACTTCTTCAGCCAGCAGCCATCTTCAATGCACACGCTCTTCTGGGCCATGAGCGGCCATGGAACCGTCCGCTCAT
ACCGACACATGGACGGCTGGGGCGTCCACACGTTCCGTCTGGTCACCGACGAAGGCAAGACCAAGTTGGTCAAGTTCCGTTTCAGAACCCAGCAGGGTCTTGCGTCACGACTATGGGAAG
AGCAGCAGCATGCTGCTGGTATGAACGCAGATACCGATAGACAGGATCTGTGGGACGCTATTGAGAATGGCTACTACCCAGAGTGGATC
TTTGAGGCGCAAATCATGGATGAGGAGGATC
AATTACGATTTGGCTTCGACCTCCTCGACCCTACCAAGATTGTGCCCGAGGATCTTGTTCCTTTCACACCATTAGGCAAGCTGACCTTGAACCGCAACCCTCGCAACTACTTCGCGGAAA
CTGAGCAAGTCATG
TTCCAAGTGGGCCACATTGTGCGTGGTATTGATTTCACCGAGGACCCTCTCATGCAAGGCCGCATCTTCTCCTACCTAGACACCCAGCTCAACCGCCACGGAGGAC
CAAACTTTGAACAGCTACCAATCAACCAACCCCGC
CGCGATGGTGCCGGACAAATGTACATTCCCCTTAACAACGCACCCTACTCGCCAAACACCTTGAACGCCGGCTCCCCAAAGCCGG
CAAACCAGACTCAGGGTCGTGGCTTCTTCTCCGCTCCAAACCGTTCCACTGGCGGTCGTCTTGTCCGCGCTGTATCTTCTACTTTTGCCGATGTTTGGTCTCAGCCGCGTCTGTTCTTCA
ACTCGCTACTGCCAGTTGAGCAACAGATGGTCATTAACGCAATGCGCTTCGAGACGGCTCAACTCACGAGCGAAGTAGTTAAGAACAATGTGTTGATCCAGCTCAACCGCGTGAGTCACG
ATATTGCTGTACGCGTCGCTGAAGCACTGGACATGACTGCACCAGCAGCAGATGATACCTACTACCACGACAACAAGACGACTGGAATCAGCGTTGCAGAGAAGAAGTTGTTGAAGCTGG
ATGGTCTGAAGGTCGGATACCTGAGTTCCGTATCCTCGAATGGCGACACCGCAGCTGCGCTCAAGACTGCGCTTAACGACCTCAAGGTCAGATTTTCTGTAGTAGGCGAGCGTCTTGGGA
AGGGCATTGACCAGACCTACTCCGCTACATTCGCAGGTCAATTTGATGCCATCGTCGTCGACGGCCAGGCAGAGGCTCTCTTCATGCCTGCTGGAAGTCTGGCAAATTCAAACACCACAG
CGAACGCTACCAAGGCATACACGACTCTCTACCCCGCTGGTCGACCCCTGTCGATCTTGCAGACTGGCTACCAATGGGGCAAAGCCGTTGGCGTAATTGGCTCAAGCAGTGCAGCCTTTA
GTGCCGCAGGCCTCCAGGCTGGCACCCCCGGTGTCTACCACTTCGAAGCAGGAAACAGTACAAAGGCGATCGTGGACCAGCTCGCTGAGGGTCTACGCACTTTCCGATTCTTGGACAG
AC
AACTTGATGAGCGTGAATTTGTTTGCGGTGTTACGGACTTTCAAGACGCCTAA

Retrieve as FASTA