Entry information : GmPrx47 (Glyma09g02650.1)
Entry ID 542
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx47 (Glyma09g02650.1)
Name (synonym) GmPrx47 (Glyma09g02650.1)
Class Class III peroxidase    [Orthogroup: Prx042]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx47
start..stop
S start..stop
GmPrx[P]261 637 0 1..344 1..344
GmPrx24 583 0 1..347 1..350
GmPrx262 541 0 1..322 1..322
GmPrx260 514 0 16..347 15..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1808707..1808919 213 N° 2 1809130..1809321 192 N° 3 1811584..1811749 166 N° 4 1812244..1812716 473
join(1808707..1808919,1809130..1809321,1811584..1811749,1812244..1812716)


exon

Literature and cross-references GmPrx47 (Glyma09g02650.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm09 (1808707..1812716)
Protein sequence: GmPrx47 (Glyma09g02650.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   37236.21 (34427.8) Transmb domain:   %s   i7-24o
PI (pH):   %s   3.94 (3.89) Peptide Signal:   %s   cut: 25 range:25-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSLRLSFFCVVVVLGALPYFSYAQLDPSFYASTCSNLSSIVREVLTNVSLSDPRMPASLIRLHFHDCFVQGCDASILLNQTDEIDSEQTAFPNDNSIRGLDVVNEIKTRLENACPGIVSCADILALAAEISSELAGGPVWEVPLGRRDGFSANQTLANENLPAPSLSIDQLISAFANQGLNITDLVALSGAHTIGRAQCKFIVDRLYDFNGTGNPDPTLNTTYLQSLQVICPDGGPGSDLTNLDLTTPDTLDSSYYSNLQLQNGLLQSDQELLSANDTDIVAIVNSFTSNQTFFFENFAASMIKMASIGVLTGSDGEIRTQCNFVNGNSSALTTKESSQDGMVSSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTCCCTTCGTCTCAGTTTTTTCTGTGTGGTGGTAGTTCTTGGAGCATTACCCTACTTCTCATATGCACAACTAGATCCCTCGTTTTACGCTAGCACATGTTCAAATTTGAGTTCA
ATCGTACGTGAGGTGCTCACAAATGTTTCCCTGTCTGATCCCCGCATGCCTGCCAGTCTCATCAGGCTCCACTTTCACGACTGTTTTGTTCAA
GTAATTAACTAGCTATATTTTTCTTAT
ATATATCTTAACTCGGTAATAATACTACTTCTGGTCCTATTTATCACTTATTTCTTGTAATTTGCGAGTGTTTTGTTTTATATATATACTCAAAGGAGGTAGCATAATATACGAGTGTTT
TGTTTTCATTTGACTCAAATTTCTTGTTGCTGAGAATTGAAGTGGAATTATGTATATATCCAGGGTTGTGATGCATCAATTCTGTTGAACCAAACGGATGAGATCGATAGTGAGCAAACT
GCTTTTCCAAATGACAACTCCATAAGAGGGTTGGATGTTGTGAACGAGATCAAGACCAGGTTGGAAAATGCTTGTCCTGGCATAGTTTCTTGTGCTGATATTCTTGCCCTTGCAGCTGAA
ATATCTTCTGAGCTG
GTATATATATGCATTTTAACTTGTTCACCTCATCTTTCATTTTCTTAGGTTTAACTTGTTCACCTCATCTTTCATTTTCTTAGGTTTATCTTACCTTTTTCTTTT
TTTCATTTATATATCACACAATATATATGATTCCAACATCTTAGTTTGTTCTAAATATATAATGTTTAATTCCATTTCGATCCAACCTAGTTTATAGAAAATCAAAATCAAAATATTTAT
AGAAAGAATCAATTTTGTGAATATTATTATGAAAAGGGTAAAATATTCATGTTTTTAGTCTCTTTAATTTTATTTTTTTTATAAAATATTTCAGTCCTCCAAATTTTTTTGTCTATTTCT
ATTTCTCCACTTTTGGTTTAAAGTAGTTATAATTAAAATCCAATGACAGTTTATAATATTCGTCAAAAAACTATTTTTTGAGGACTAAAAATAGAGTATATGTAAGTTAGAGAATAGAAA
TAGGACAACAAAATTTTGGACGGCTAAAACCGATTCTAAAAAATTTAGAAGAAGTAAAAATATATTTTTTCCATATAAAAATATGAAAAACCAATGTTCCTTAATTAGGGTTGGTTTGAT
TTCCTTCACACTTTTGGTTCAAAAAAACTGGTTTTTAAAATAATTATTCCATCCTACTCAATAATTAATTTCTAATCCAAAACCTATCGAGTTTTAAAAGTAATTTTTAAAAAAGTGTTT
TAAAAAGTAAGAATAAAAAAACAGAAATATATGAGAAATGTTTACTCAATGTTTTATTTTTCTTATTCTATATATTTTATTGTCCTAGTTCAATGATACGGATCATATAAAGTGATATTG
CATGAGATGAAGTATATGAACTTGGTATTGATTTTCTGTTATTTTTAAACCTAATTTAACTAAAAATCATTTTTAAAAATAGAAATCAAACCCCCCTTAAAGTTTCCAAGTGATGTTTAG
AAGTTCCAATGAAAACCTATATGAAACTAGAGAGAATAGTTATAACTTGATAAGTGATAGGAATATAAAATAGATTAGTTATTCATGAAATATTTATTTTATTAATTATGTATTCAACTT
TAATATTTTTAAAAATAGATAATCTCAAACCAAATATATTTTATAGGAATATAGTTAGATTGAATTATTTAAATAAGTCATATCTAAGTTTTGTAGGCTTGACATCAATAGTTCACAAAT
AATTTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAAAATATTTTTGTATTGTCATTTAATCACAAATATATGATACT
GCTACACACACAAAAATACTAGATTTTATTTTTTTATTAACAACAATCGTAATAATTTGATTTGGAATTTAATTATACTTAAAATTTCTCATATTTTACTTTATTTTTTAGCACAAAGAT
ATGGATTAAATACTAAATTAATAAACAAGATTTTATTTAAAAATAAATTTAATGATAAACAAACTATAATCAAGACATAAATAAGTTAATACGTCAAGCTCAAATTTTTTTGATAGGTTT
GACTTATTCACATCACTAAACAGTGAGATGTGATAAATATAAATAAAGAGAAAAACAAATAAATATATAAATTAGTGAGTTTGGATTAGGATGATAATTTTTGAAGAATGAGAGATTAGT
AAGAACTGCAAAAAGAAAAAATCATTTTAGGTAAATTGTATGTTTTAGTTAGTGAGTTCAGTCAAAGACGATTTCATATCATTGAATTGATTCATTTTGTGAAGGTTATAAGTAGAACAC
GAAAATTTGGAGATTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA
AAAAAGTAAAGGAATTTACTCTATATATTTTTCTGCTATATATAATTTTAGAAGTTATGCAAAGCAATTGTGTAAAAAACTATTTATTGAAAAATTAATTACCTTCATTTTATTTTTATT
TTAATCTTATTAAGAAAACAATTTAATTGTTTTTTGCCTGTTTTGGTGGTCTACTTTAAATTATGATTGTGGTCACATATTCGACCATTATTTAATAAGAATACATGGGGTTGAAGAATT
GATTAAAACAAATCATTGTCAAGCATAAAACTAAATTTCCTGGTGGAATTTTGATCTTAATTAATTGAAACCATAAGTTCTTAACAATTTTTGTTCACCTTTTGTACTATTTGGCAGGCT
GGTGGTCCTGTTTGGGAAGTTCCACTGGGAAGAAGGGATGGTTTTTCAGCAAATCAAACACTTGCTAATGAAAATCTTCCTGCTCCTAGTCTTAGCATTGATCAACTTATATCCGCATTT
GCTAATCAAGGCCTCAACATTACTGATCTAGTTGCACTTTCAG
GTATGAGATTTTTTGCATTAATAAAAAGAAGGTTTTATGATGTGGTTTCAAGCCCAGTATGAAAATATTATATATAT
ATATATGTGTGTGTGTGTGTGTCAAATGCTTTAAATTGATTAAATAAGTAAAGAATAAACGAGATGAGTTTTCTTTTATATGGTTGTACATGTATCCATATTGCTACTCTTGTTTTGTTA
AACTAATAATTTAGATAAATTTTATCAAATTCTTTCTTTGGCAATGAATGCTCTTGTTATAATCAAATTTAATTAAACAAAAGTAGCAATGTATATCAAATGACAATGTCAATGGAGTAC
TACTCGGTTACTTGAACTCGAAACGTGAATTATTCTAAATCCCTAGTATTTTTCTGTGATTCAGATAAAAAAAAAATATTGCAATGAATGCTCTTAATTGTAACCAAAAAGGCAATGAAA
ACCCTTAAATAAGAATGGCATTTGTTGTATTACTTACTAAAAATGTTTAATTTTTAGGTGCTCATACAATTGGTAGAGCTCAATGCAAGTTTATTGTTGATCGATTATACGATTTCAATG
GCACCGGCAATCCAGATCCTACTCTCAACACAACTTACTTACAATCATTGCAAGTAATATGTCCCGATGGTGGACCTGGCTCTGATCTCACCAATTTGGACTTAACCACTCCTGACACGT
TGGACTCAAGTTACTACTCCAATCTTCAACTTCAAAATGGCTTGCTTCAGAGTGACCAAGAGCTTCTTAGCGCAAACGATACTGACATTGTTGCCATTGTCAACAGTTTCACTAGTAACC
AAACTTTTTTCTTTGAAAACTTTGCAGCATCAATGATTAAAATGGCCAGCATTGGAGTGCTAACGGGATCAGATGGAGAAATTCGAACACAATGTAATTTTGTGAACGGAAATTCTTCTG
CTCTTACCACCAAAGAATCTTCACAAGATGGCATGGTTAGCTCAATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTCCCTTCGTCTCAGTTTTTTCTGTGTGGTGGTAGTTCTTGGAGCATTACCCTACTTCTCATATGCACAACTAGATCCCTCGTTTTACGCTAGCACATGTTCAAATTTGAGTTCA
ATCGTACGTGAGGTGCTCACAAATGTTTCCCTGTCTGATCCCCGCATGCCTGCCAGTCTCATCAGGCTCCACTTTCACGACTGTTTTGTTCAA
GGTTGTGATGCATCAATTCTGTTGAAC
CAAACGGATGAGATCGATAGTGAGCAAACTGCTTTTCCAAATGACAACTCCATAAGAGGGTTGGATGTTGTGAACGAGATCAAGACCAGGTTGGAAAATGCTTGTCCTGGCATAGTTTCT
TGTGCTGATATTCTTGCCCTTGCAGCTGAAATATCTTCTGAGCTG
GCTGGTGGTCCTGTTTGGGAAGTTCCACTGGGAAGAAGGGATGGTTTTTCAGCAAATCAAACACTTGCTAATGAA
AATCTTCCTGCTCCTAGTCTTAGCATTGATCAACTTATATCCGCATTTGCTAATCAAGGCCTCAACATTACTGATCTAGTTGCACTTTCAG
GTGCTCATACAATTGGTAGAGCTCAATGC
AAGTTTATTGTTGATCGATTATACGATTTCAATGGCACCGGCAATCCAGATCCTACTCTCAACACAACTTACTTACAATCATTGCAAGTAATATGTCCCGATGGTGGACCTGGCTCTGAT
CTCACCAATTTGGACTTAACCACTCCTGACACGTTGGACTCAAGTTACTACTCCAATCTTCAACTTCAAAATGGCTTGCTTCAGAGTGACCAAGAGCTTCTTAGCGCAAACGATACTGAC
ATTGTTGCCATTGTCAACAGTTTCACTAGTAACCAAACTTTTTTCTTTGAAAACTTTGCAGCATCAATGATTAAAATGGCCAGCATTGGAGTGCTAACGGGATCAGATGGAGAAATTCGA
ACACAATGTAATTTTGTGAACGGAAATTCTTCTGCTCTTACCACCAAAGAATCTTCACAAGATGGCATGGTTAGCTCAATGTAA

Retrieve as FASTA