Entry information : OsRboh03(LOC_Os01g61880 / OsNox03 / OsRbohE)
Entry ID 5565
Creation 2007-07-18 (Christophe Dunand)
Last sequence changes 2007-07-18 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-28 (Christophe Dunand)
Peroxidase information: OsRboh03(LOC_Os01g61880 / OsNox03 / OsRbohE)
Name OsRboh03(LOC_Os01g61880 / OsNox03 / OsRbohE)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Flowers
Inflorescences
Leaves
Roots
Seeds
Stems
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh03
start..stop
S start..stop
SbRboh05 1558 0 19..843 28..854
BdiRboh06 1533 0 33..843 97..907
ZmRboh03 1528 0 18..843 37..852
OsRboh04 1377 0 22..843 9..819
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35806557..35806932 376 N° 2 35807517..35807679 163 N° 3 35807789..35807837 49 N° 4 35807943..35808866 924
N° 5 35808954..35809049 96 N° 6 35809142..35809257 116 N° 7 35809345..35809447 103 N° 8 35809570..35809658 89
N° 9 35809750..35809900 151 N° 10 35809995..35810141 147 N° 11 35810238..35810366 129 N° 12 35810451..35810529 79
N° 13 35810616..35810725 110  
join(35806557..35806932,35807517..35807679,35807789..35807837,35807943..35808866 ,35808954..35809049,35809142..35809257,35809345..35809447,35809570..35809658,358 09750..35809900,35809995..35810141,35810238..35810366,35810451..35810529,3581061 6..35810725)


exon

Literature and cross-references OsRboh03(LOC_Os01g61880 / OsNox03 / OsRbohE)
Literature Sasaki T., et al., The genome sequence and structure of rice chromosome 1. Nature 420:312-316(2002).
Protein ref. UniProtKB:   Q8S1T0   Q5QMH3 [Incorrect splicing]   Q5QMH4 [Incorrect splicing]
DNA ref. GenBank:   NC_008394.1 (35806557..35810722)
mRNA ref. GenBank:   AK100241 [Sequencing error]
Cluster/Prediction ref. UniGene:   Os.91330
Protein sequence: OsRboh03(LOC_Os01g61880 / OsNox03 / OsRbohE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   843 (310)
PWM (Da):   %s   94582.5 (33614.8) Transmb domain:   %s   o293-311i426-448o474-496i661-678o
PI (pH):   %s   9.75 (7.53) Peptide Signal:   %s   cut: 27 range:27-336
Sequence 884
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASPYDHQSPHAQHPSGLPRPPGAGAGAAAGGFARGLMKQPSRLASGVRQFASRVSMKVPEGVGGMRPGGGRMTRMQSSAQVGLRGLRFLDKTSGGKEGWKSVERRFDEMNRNGRLPKESFGKCIGMGDSKEFAGELFVALARRRNLEPEDGITKEQLKEFWEEMTDQNFDSRLRIFFDMCDKNGDGMLTEDEVKEVIILSASANKLAKLKGHAATYASLIMEELDPDDRGYIEIWQLETLLRGMVSAQAAPEKMKRTTSSLARTMIPSRYRSPLKRHVSRTVDFVHENWKRIWLVALWLAVNVGLFAYKFEQYERRAAFQVMGHCVCVAKGAAEVLKLNMALILLPVCRNTLTTLRSTALSHVIPFDDNINFHKVIAATIAAATAVHTLAHVTCDFPRLINCPSDKFMATLGPNFGYRQPTYADLLESAPGVTGILMIIIMSFSFTLATHSFRRSVVKLPSPLHHLAGFNAFWYAHHLLVLAYVLLVVHSYFIFLTREWYKKTTWMYLIVPVLFYACERTIRKVRENNYRVSIVKAAIYPGNVLSLHMKKPPGFKYKSGMYLFVKCPDVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTTELRNLFGKACEAQVTSKKATLSRLETTVVADAQTEDTRFPKVLIDGPYGAPAQNYKKYDILLLIGLGIGATPFISILKDLLNNIKSNEEVESIHGSEIGSFKNNGPGRAYFYWVTREQGSFEWFKGVMNDVAESDHNNIIEMHNYLTSVYEEGDARSALIAMVQSLQHAKNGVDIVSGSRIRTHFARPNWRKVFSDLANAHKNSRIGVFYCGSPTLTKQLKDLSKEFSQTTTTRFHFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo, 12 introns), 4 mRNA and 26 ESTs. Three SwissProt/TREMBL accessions: Q8S1T0, Q5QMH4 (uncorrect prediction) and Q5QMH3 (uncorrect prediction).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGTCGCCGTACGACCACCAGTCGCCGCATGCGCAGCACCCGTCGGGGTTGCCGAGGCCGCCGGGGGCGGGGGCGGGTGCGGCGGCGGGCGGGTTCGCGCGGGGGCTGATGAAGCAGC
CGTCGCGGCTGGCGTCCGGGGTGAGGCAGTTCGCGTCGAGGGTGTCGATGAAGGTGCCGGAGGGGGTGGGGGGGATGCGGCCCGGTGGCGGGAGGATGACGCGGATGCAGTCCAGCGCGC
AGGTGGGGCTCCGGGGGCTCCGCTTCCTCGACAAGACGTCCGGCGGGAAGGAGGGGTGGAAGTCCGTCGAGCGCCGCTTCGACGAGATGAACCGCAACGGCCGCCTCCCCAAGGAGAGCT
TCGGCAAGTGCATCG
GTGAGTCCCCGGCCCGCAGCTTCCATCGATGGTGCGATCCAGAAACAGATAGCCGTAAATTCAGTTCCAAAAGGGCGATTAGTTGTTGCTAACAAGAACACAGCA
GAAATATCTCTGATTGAAGGAATATTGTGTTGGCGCCATCTTTCTTGTTTTCTGTCAATCATTTTTATGCTCCGCAACAGTTGTGTGATGATGCCGTGAACTGTTCATCTTTGCCCAAAG
AGTTGGCAGGGACAGCTCTGCCTAACTGAGATCGGCTCTTTGCTTCTCAACTAATCCCCTCGAATTAATGCTTTTGCTTTGCGAAATGGTCCATTATTAAGCAGTAAATCGGTACAGCAA
AAGAAACGAGTACTCTGTACTTCTCTTTTGTTATTGCACATGCTTACGGAGAAAATGGAGTTATAGCGACCGGTTCATGCTGGAGGCAGTTAGGCGATCGATGGAATAATAATCGTGTAG
CGCTAAGCGAATCATTTCTCTTTTTAGATAGTTTGGATGTCTAACAATGCCCATGATTCATGATCTTTTAATTGAACTAAGAAAAATTAATCCATGGTGGATCTGCTTGGCATCAAAAGG
CATGGGGGACTCCAAGGAGTTCGCCGGCGAGCTGTTCGTGGCGCTGGCGCGGCGGAGGAACCTGGAGCCGGAGGACGGCATCACCAAGGAGCAGCTCAAGGAGTTCTGGGAGGAGATGAC
CGACCAGAACTTCGACTCGCGGCTTCGCATTTTCTTTGACAT
GTAATGGTTCACCGTCCCAGTTATAATTTCCAAGATGAACACGATAAATCGATCGCCAACTGACGAAATGGATTTTTT
TTTTCCTTCCCCCTCTCTCTGATGCATCCAGGTGCGACAAGAATGGCGATGGGATGCTCACGGAAGATGAGGTCAAGGAGGTGAGGACGAAAGAATTCTTCTGGATTGGATCTCATCTGC
CATTCTGGAACATGGAGAGAGAGGATTAAATATCGTTTTCTTGTTTGGCTGGAATGGATTTGCAGGTTATTATACTGAGTGCGTCGGCGAACAAGCTGGCGAAGCTGAAGGGACACGCGG
CGACGTACGCGTCGCTGATCATGGAGGAGCTGGACCCGGACGACCGCGGGTACATCGAGATCTGGCAGCTGGAGACGCTGCTGCGCGGCATGGTGAGCGCGCAGGCGGCGCCGGAGAAGA
TGAAGCGGACGACGTCGAGCCTCGCGAGGACGATGATCCCGTCGCGGTACCGGAGCCCGCTGAAGCGGCACGTGTCCAGGACGGTGGACTTCGTGCACGAGAACTGGAAGCGGATCTGGC
TCGTCGCGCTGTGGCTCGCCGTCAACGTCGGCCTCTTCGCCTACAAGTTCGAGCAGTACGAGCGGCGCGCCGCGTTCCAGGTGATGGGCCACTGCGTGTGCGTGGCCAAGGGCGCCGCCG
AGGTGCTCAAGCTCAACATGGCGCTCATCCTCCTCCCCGTGTGCCGGAACACGCTCACCACGCTCAGGTCCACGGCGCTCAGCCACGTCATCCCCTTCGACGACAACATCAACTTCCACA
AGGTGATCGCGGCGACCATCGCCGCCGCCACCGCCGTCCACACGCTGGCGCACGTCACCTGCGACTTCCCGAGGCTGATCAACTGCCCCAGCGACAAGTTCATGGCGACGCTGGGGCCGA
ACTTCGGGTACAGGCAGCCGACGTACGCCGACCTGCTGGAGAGCGCCCCCGGCGTCACCGGCATCCTCATGATCATCATCATGTCCTTCTCCTTCACGCTGGCCACGCACTCCTTCCGCC
GGAGCGTCGTCAAGCTGCCGTCGCCGCTGCACCACCTCGCCGGCTTCAACGCCTTCTGGTACGCGCACCACCTCCTGGTGCTCGCCTACGTCCTCCTCGTCGTGCACTCCTACTTCATAT
TCCTCACCAGGGAGTGGTACAAGAAAACG
GTAAAATTCTCATCAGGCGCTCGATCTTCCTGTGACTGCAATGAAATTAAGTGACATCATCTCAAAATGTCAATCTTGTTCCTGCAGACAT
GGATGTACCTGATAGTCCCAGTGCTCTTCTATGCATGCGAGAGAACGATCAGAAAAGTTCGAGAGAACAACTACCGCGTGAGCATCGTCAAG
GTAAGCAGCTGACTCATGTAACTGGGAT
CCATTCTTTCTTAGCTGTTTGCCTGTTACTCATAAAATTGGTGATGTGGGTGTGGCACATGCAGGCAGCGATTTACCCAGGAAATGTGCTCTCTCTTCACATGAAGAAGCCGCCGGGTTT
CAAGTACAAGAGCGGGATGTACCTGTTTGTGAAGTGCCCTGATGTCTCTCCTTTCGAATG
GTAACCAATTCACCCTTGTCGCATGAATGCATGTCCAAAATGTGGTTTATCTGAGACTAT
TTCTAACTGTTTTTCCTGCCTTTGCAGGCATCCCTTCTCCATCACTTCTGCACCTGGAGATGACTACCTGAGTGTGCATATCCGTACACTAGGTGACTGGACGACTGAACTCAGAAACCT
GTTTGGGAAG
GTCAGTTGAGGCAGCACAGCTGCAAAGAGTTGCAAGAACAATTAGTTTCCCTCGTTAAACAATTCTAGGAGAATAATGCAGATTGCCAAAAGATGGAGAACTAAATCTTA
GTATTCATGTAGGCTTGCGAGGCACAGGTTACTTCTAAGAAGGCTACCCTTTCAAGACTTGAAACTACAGTTGTGGCGGACGCTCAGACAGAGGATACTAGGTGACTAGAGAAGCTCTTC
TATTTCACCTACCAAATGCATTTGGTCTACAATCATTTTCTAACCCTGGTTATCTTCACAATGTTGCTTCAGGTTTCCTAAGGTCCTTATTGATGGGCCCTATGGTGCACCGGCGCAAAA
CTACAAGAAGTATGACATTCTTTTGCTTATTGGTCTTGGAATTGGTGCTACTCCTTTCATCAGCATTCTGAAGGATCTGTTGAACAACATTAAATCCAACGAA
GTAAAATTCTTCCCTGA
TAAATAGTGTTTCCTTATTTCCTACAATGTTGTATAACTGGAGGAAATAGATAACTAAAATGAGTTGATGGCAACAGGAGGTGGAAAGCATACATGGTTCTGAGATAGGCAGCTTCAAGA
ACAATGGGCCAGGAAGAGCTTACTTCTACTGGGTGACCAGAGAGCAAGGGTCCTTCGAGTGGTTTAAAGGAGTCATGAACGATGTCGCTGAAAGTGATCACAAT
GTACTGTCTCACTCTC
AATTCTTCGCTGTATTTTCAAATTTCCATAGTTCCTTCAGTCATAGATAGAACATAAACTAATATATGTGGGAATTGCAGAATATTATAGAGATGCACAATTACCTGACCAGCGTGTATG
AAGAAGGCGACGCAAGGTCAGCTTTGATTGCCATGGTTCAGTCACTTCAACATGCCAAAAATGGTGTGGATATCGTCTCCGGCAGCAGG
GTATTCGACATCTTCCCCCTCTTCTATCTGA
AATACTTATTTATTTCCAGTGTATTCCTCTTATTTCTGATTGATCTGTTGCAGATTCGCACACATTTTGCGAGGCCTAACTGGAGAAAGGTGTTCTCTGACTTGGCGAATGCCCACAAAA
ACTCACGCATAG
GTGAGCCTCTTTTTTCAGCGAACATCGTCGATGCAACAATTTTGAGCTTTGCAGTAACGGTTGTTAACAAATCCATAAATATGCAGGTGTTTTCTATTGTGGATCCCC
TACACTCACGAAACAACTCAAGGATCTTTCAAAAGAATTCAGCCAGACAACCACAACTAGATTCCACTTCCACAAGGAAAACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGTCGCCGTACGACCACCAGTCGCCGCATGCGCAGCACCCGTCGGGGTTGCCGAGGCCGCCGGGGGCGGGGGCGGGTGCGGCGGCGGGCGGGTTCGCGCGGGGGCTGATGAAGCAGC
CGTCGCGGCTGGCGTCCGGGGTGAGGCAGTTCGCGTCGAGGGTGTCGATGAAGGTGCCGGAGGGGGTGGGGGGGATGCGGCCCGGTGGCGGGAGGATGACGCGGATGCAGTCCAGCGCGC
AGGTGGGGCTCCGGGGGCTCCGCTTCCTCGACAAGACGTCCGGCGGGAAGGAGGGGTGGAAGTCCGTCGAGCGCCGCTTCGACGAGATGAACCGCAACGGCCGCCTCCCCAAGGAGAGCT
TCGGCAAGTGCATCG
GCATGGGGGACTCCAAGGAGTTCGCCGGCGAGCTGTTCGTGGCGCTGGCGCGGCGGAGGAACCTGGAGCCGGAGGACGGCATCACCAAGGAGCAGCTCAAGGAGT
TCTGGGAGGAGATGACCGACCAGAACTTCGACTCGCGGCTTCGCATTTTCTTTGACAT
GTGCGACAAGAATGGCGATGGGATGCTCACGGAAGATGAGGTCAAGGAGGTTATTATACTGA
GTGCGTCGGCGAACAAGCTGGCGAAGCTGAAGGGACACGCGGCGACGTACGCGTCGCTGATCATGGAGGAGCTGGACCCGGACGACCGCGGGTACATCGAGATCTGGCAGCTGGAGACGC
TGCTGCGCGGCATGGTGAGCGCGCAGGCGGCGCCGGAGAAGATGAAGCGGACGACGTCGAGCCTCGCGAGGACGATGATCCCGTCGCGGTACCGGAGCCCGCTGAAGCGGCACGTGTCCA
GGACGGTGGACTTCGTGCACGAGAACTGGAAGCGGATCTGGCTCGTCGCGCTGTGGCTCGCCGTCAACGTCGGCCTCTTCGCCTACAAGTTCGAGCAGTACGAGCGGCGCGCCGCGTTCC
AGGTGATGGGCCACTGCGTGTGCGTGGCCAAGGGCGCCGCCGAGGTGCTCAAGCTCAACATGGCGCTCATCCTCCTCCCCGTGTGCCGGAACACGCTCACCACGCTCAGGTCCACGGCGC
TCAGCCACGTCATCCCCTTCGACGACAACATCAACTTCCACAAGGTGATCGCGGCGACCATCGCCGCCGCCACCGCCGTCCACACGCTGGCGCACGTCACCTGCGACTTCCCGAGGCTGA
TCAACTGCCCCAGCGACAAGTTCATGGCGACGCTGGGGCCGAACTTCGGGTACAGGCAGCCGACGTACGCCGACCTGCTGGAGAGCGCCCCCGGCGTCACCGGCATCCTCATGATCATCA
TCATGTCCTTCTCCTTCACGCTGGCCACGCACTCCTTCCGCCGGAGCGTCGTCAAGCTGCCGTCGCCGCTGCACCACCTCGCCGGCTTCAACGCCTTCTGGTACGCGCACCACCTCCTGG
TGCTCGCCTACGTCCTCCTCGTCGTGCACTCCTACTTCATATTCCTCACCAGGGAGTGGTACAAGAAAACG
ACATGGATGTACCTGATAGTCCCAGTGCTCTTCTATGCATGCGAGAGAA
CGATCAGAAAAGTTCGAGAGAACAACTACCGCGTGAGCATCGTCAAG
GCAGCGATTTACCCAGGAAATGTGCTCTCTCTTCACATGAAGAAGCCGCCGGGTTTCAAGTACAAGAGCGGGA
TGTACCTGTTTGTGAAGTGCCCTGATGTCTCTCCTTTCGAATG
GCATCCCTTCTCCATCACTTCTGCACCTGGAGATGACTACCTGAGTGTGCATATCCGTACACTAGGTGACTGGACGA
CTGAACTCAGAAACCTGTTTGGGAAG
GCTTGCGAGGCACAGGTTACTTCTAAGAAGGCTACCCTTTCAAGACTTGAAACTACAGTTGTGGCGGACGCTCAGACAGAGGATACTAGGTTTC
CTAAGGTCCTTATTGATGGGCCCTATGGTGCACCGGCGCAAAACTACAAGAAGTATGACATTCTTTTGCTTATTGGTCTTGGAATTGGTGCTACTCCTTTCATCAGCATTCTGAAGGATC
TGTTGAACAACATTAAATCCAACGAA
GAGGTGGAAAGCATACATGGTTCTGAGATAGGCAGCTTCAAGAACAATGGGCCAGGAAGAGCTTACTTCTACTGGGTGACCAGAGAGCAAGGGT
CCTTCGAGTGGTTTAAAGGAGTCATGAACGATGTCGCTGAAAGTGATCACAAT
AATATTATAGAGATGCACAATTACCTGACCAGCGTGTATGAAGAAGGCGACGCAAGGTCAGCTTTGA
TTGCCATGGTTCAGTCACTTCAACATGCCAAAAATGGTGTGGATATCGTCTCCGGCAGCAGG
ATTCGCACACATTTTGCGAGGCCTAACTGGAGAAAGGTGTTCTCTGACTTGGCGAATG
CCCACAAAAACTCACGCATAG
GTGTTTTCTATTGTGGATCCCCTACACTCACGAAACAACTCAAGGATCTTTCAAAAGAATTCAGCCAGACAACCACAACTAGATTCCACTTCCACAAGG
AAAACTTTTAA

Retrieve as FASTA