Entry information : OsRboh09(LOC_Os12g35610 / OsNox09 / OsRbohH)
Entry ID 5566
Creation 2007-07-19 (Christophe Dunand)
Last sequence changes 2007-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-28 (Christophe Dunand)
Peroxidase information: OsRboh09(LOC_Os12g35610 / OsNox09 / OsRbohH)
Name OsRboh09(LOC_Os12g35610 / OsNox09 / OsRbohH)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Abomasum
Callus
Flowers
Inflorescences
Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh09
start..stop
S start..stop
ZmRboh10 1410 0 23..909 26..891
SbRboh08 1384 0 7..909 5..916
ToriRboh01 1175 0 27..909 50..904
AeveRboh03 1173 0 8..909 25..895
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21682386..21682944 559 N° 2 21683042..21683201 160 N° 3 21683419..21683467 49 N° 4 21683570..21683683 114
N° 5 21683863..21684294 432 N° 6 21684594..21684980 387 N° 7 21685074..21685172 99 N° 8 21685380..21685495 116
N° 9 21685605..21685707 103 N° 10 21685817..21685890 74 N° 11 21686387..21687023 637  
join(21682386..21682944,21683042..21683201,21683419..21683467,21683570..21683683 ,21683863..21684294,21684594..21684980,21685074..21685172,21685380..21685495,216 85605..21685707,21685817..21685890,21686387..21687023)


exon

Literature and cross-references OsRboh09(LOC_Os12g35610 / OsNox09 / OsRbohH)
Literature IRGSP(International Rice Genome Sequencing Project). Oryza sativa nipponbare(GA3) genomic DNA, chromosome 12.
Protein ref. UniProtKB:   A3CI53   Q0IMU2   Q2QP56
DNA ref. GenBank:   NC_008405.1 (21682386..21687020)
Cluster/Prediction ref. UniGene:   Os.73981
Protein sequence: OsRboh09(LOC_Os12g35610 / OsNox09 / OsRbohH)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   909
PWM (Da):   %s   101910.93 Transmb domain:   %s   o354-376i487-509o537-559i720-737o
PI (pH):   %s   9.36
Sequence 950
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASREESGNGGGGGATPAADYRSSDSRSSSRRSTRFKEDNEYVEITLDVKGDDTVAIQSIRNGADMPEVALLARGLAQQPPPSAAPGPGGLSSRLKAVRTELRRIASWKFPSGVLSGGGGGGDAPGNGNDRRPRLDRSMTGAARALRGLQFLNSSAVTNGWPEVEKRFERLAVDGFLLRSRFGQCIGMVGSEEFAVQIFDSLARRRGITAQLLTKDQLREFWEQLSDPGFDAKLQTFFDMVDKNADGQITEEELKEVLTLTASANKLSKILERVDEYTALIMEELDPDQLGYIDISNLESLLLLPPSQAPSKLVTHSSNISQLISQKLVPTHDRNPLRRGLRRLSYFMEDNWKRVWVMALWLAINAGLFTWKFMAYKRHPTFDVMGYCVCVAKGGAETTKFNMALILLPVCRNTITWLRSRTKLGAVIPFNDNINFHKVVAGGVVVGVALHGVTHLTCDFPRLLHASDAAYEPMKKYFGQTRIPDYWWFVRGVEGITGVIMVVLMAIAYTLAHPWFRRSKLSDSNPLKRLSGFNMFWYSHHLFVIVYIAFVVHGVCLYINRTWWKQTTWMYLAIPILLYAGERIFRALRSHGFTTVRIEKVAIYPGNVIAIHMTKPHGFKYKSGQYIYVNCGEVSPFEWHPFTITSAPDDSYLSMHIRCRGDWTSSFRAIFSQICRPPMNGQSGLLRADCMSMEHHSRFPKLLIDGPYGAPAQDYWKYDVLLLIGLGIGATPLISIVKDVLNHIYDDPESAASPHTTNGGGAAAAARRAFMTKRVYFYWCTREEGSFEWFRGVMNEVADRDAGRELIELHNHCTSVYEEGDARSALVTMLQALHHAKNGVDVVSGTRVRTHFARPSWRDVFKRVAVNHQGQRVGVFFCGDQALTPELRRLAQDFSHKTTTKFVFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 12, 9 introns), 1 mRNA and 20 ESTs. Three SwissProt/TREMBL accessions: Q2QP56, Q0IMU2 (extra and missing sequences) and A3CI53 (extra and missing sequences).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGAGCCGGGAGGAGAGCGGCAATGGCGGTGGCGGTGGCGCGACGCCGGCGGCGGATTACCGGAGCTCGGACAGCCGGAGCTCGAGCCGGCGGAGCACGCGGTTCAAGGAGGACAACG
AGTACGTGGAGATCACGCTCGACGTCAAGGGCGACGACACGGTCGCCATCCAGAGCATCCGCAACGGCGCCGACATGCCCGAGGTCGCCCTCCTCGCGCGCGGCCTCGCGCAGCAGCCGC
CGCCGTCCGCGGCGCCCGGCCCCGGCGGGCTCTCGTCGCGGCTCAAGGCGGTGAGGACCGAGCTGAGGCGGATCGCGTCGTGGAAGTTCCCCAGCGGCGTTCTCAGCGGCGGCGGCGGCG
GCGGCGACGCGCCGGGCAACGGCAACGACCGCCGCCCTCGCCTCGACCGGAGCATGACCGGCGCCGCCCGCGCGCTGCGCGGGCTCCAGTTCCTCAACTCCAGCGCCGTCACCAATGGCT
GGCCGGAGGTGGAGAAGAGGTTCGAGCGCCTCGCCGTCGACGGCTTCCTCCTCCGCTCCCGCTTCGGCCAGTGCATCG
GTCAGCTCAAGCTCAAGCTCACCTCTGAAAATTCCTCTAAAT
TTCTGATGAATTCGAACTGAAACCGACTGAATTTTCTCGCCAAATCGTGTTCCAGGAATGGTTGGATCCGAGGAGTTTGCGGTTCAGATCTTCGACTCGCTTGCGCGGCGGCGAGGGATC
ACGGCTCAGTTGCTGACCAAGGATCAGCTCCGGGAGTTTTGGGAGCAGCTCTCTGATCCAGGATTTGATGCCAAGCTGCAGACTTTCTTTGACAT
GTATGTGTTCAGTTCTATCAAAAAT
TCAAGTTTACATTCAGTCTTGAAGTAGTAGAATTTTAGTCGTTCAAATATTGTTAGTTGCACATGTTTTGTCTTGTAATAGTGAAATTTGCCACTGAACCTTTTGATTAGTATGCACATA
GATTCAGTTATGACTTTTGGAAAGGGACTCTGAAGTTTGTTGACTGACATCTGAGTGCTGAATTTCTTGCAGGGTTGACAAGAATGCAGATGGTCAGATCACTGAAGAGGAGCTCAAAGA
G
GTAAGAAACTGGATCAAAGCAACACAAAAAAAAAATTAAGCATAATTTTTCCATGTAATTTGAAGCAGATTGAGGATTCTGAATTTTTCTTGCATTTTTCAGGTCCTCACCCTGACTGC
CTCTGCAAACAAGCTGTCCAAGATCCTGGAGCGCGTCGACGAGTACACCGCGCTGATCATGGAGGAGCTCGATCCCGATCAATTAGGCTACATAGAT
GTACATACTCTCACCCTCAAATC
CTCCACATATTTGAAAAAATATATATATCTGAATTTGACATTGTTAAGAACAAGAATCTATGCAATTCTGAATCTGAAATTGTTCAGAGTACTAGAGTAGCAGTATCTGCAATTCTGAAT
TCTGACACTGTTCATGGTCACCTCCCATTTCCAAAGATATCAAACCTGGAGTCGCTGCTGCTGCTGCCGCCGTCGCAGGCGCCGTCGAAGCTGGTGACGCACAGCTCCAACATCAGCCAG
CTGATCAGCCAGAAGCTGGTGCCGACGCACGACCGGAACCCGCTCCGGCGGGGGCTCCGGCGGCTGTCCTACTTCATGGAGGACAACTGGAAGCGGGTGTGGGTGATGGCGCTGTGGCTG
GCCATCAACGCCGGCCTCTTCACCTGGAAGTTCATGGCGTACAAGCGCCACCCGACGTTCGACGTCATGGGCTACTGCGTCTGCGTCGCCAAGGGCGGTGCCGAGACCACCAAGTTCAAC
ATGGCCCTCATCCTCCTCCCCGTTTGCCGGAACACCATCACCTGGCTCCGTTCTCGCACCAAGCTCGGCGCCGTCATCCCCTTCAATGACAACATCAACTTCCACAAG
GTAACACTCTTT
CACACAAGTATTTTTACGGTGATCTCTACTGTTAGTAGAATATGTACCGCTACTAGTATTATCACCAGTAGAAGCGATCTAAATCATTGATTTATAAATTCTACTGGTAGAAACAATATC
GTACCATCGATAGTTAAGGTTGTACTATAAATAGACATTGTCCATTTGACGAGGGAGAAAAACAAAATAAAAGGTTCAGATTTATCCTATTACAATATTACCGGTAGAGAACATCGTAAA
AACTCAGTAAGGTCATTATTGACAGTTGTCTTCTCCGGTGACGGCAGGTGGTGGCAGGGGGAGTGGTGGTAGGGGTGGCGCTGCACGGGGTGACTCACCTGACGTGCGACTTCCCGAGGC
TGCTGCACGCGAGTGATGCGGCGTACGAGCCGATGAAGAAGTACTTCGGGCAGACACGGATCCCGGACTACTGGTGGTTCGTGCGCGGCGTAGAGGGGATCACCGGCGTGATCATGGTGG
TGCTCATGGCCATCGCCTACACGCTGGCGCACCCGTGGTTCCGCCGGAGCAAGCTTAGTGACAGCAACCCGCTGAAGCGGCTCAGCGGTTTCAATATGTTTTGGTACTCCCACCACCTCT
TCGTCATCGTCTACATCGCCTTCGTTGTCCATGGCGTCTGCCTCTACATCAACCGGACTTGGTGGAAGCAGACG
GTGAGTGAGCCAGCTTCTGGTCGATTTGCGCCCGTCGGGTTCTTTG
TGGTCTGAATTCTAAAAAATGTTGCTAACTTTTGTGTGATTTTTCAGACATGGATGTACCTTGCCATCCCTATCCTGCTCTACGCCGGTGAGCGGATTTTCCGGGCTCTGAGGTCTCATG
GCTTCACCACCGTAAGGATTGAGAAG
GTAACCCAACTCTTTTTTGTTTAACATCAAAAAGAAAATTAGTTCTGTAGCACTGAAAGTTTATGGGAAAAAAAACTTTATTAGCACAGAAAGA
TCTTTCTGTTCACTTTGACACGACAATTTCTTTCCCTGCAAATGTATACTGATATGGTACTGAATTCTGTTCAAGGAAATTGAATTAAAATGGGGTAAATTTGAAACGTGCAGGTTGCAA
TCTATCCTGGCAACGTGATAGCCATCCACATGACCAAGCCCCATGGGTTCAAGTACAAGAGTGGCCAGTACATCTATGTTAACTGCGGCGAGGTCTCGCCATTCGAGTG
GTAAATCCTCA
AATTCCTCAAAATTCTCCGGTCGCGGCACGCGAACCAATACTGGTTTTCACCTGACGATTGTTCACAACTGATCATGCCAATGCTTGTGTCATGACAGGCACCCGTTCACCATCACCTCG
GCTCCCGACGACAGCTATCTCAGCATGCATATCCGGTGCCGCGGTGACTGGACCTCGAGCTTCAGGGCCATCTTCTCTCAG
GCAAGCTGATCGCCGAGCCACCATGGCGAATCGGGGAAA
ATTTCGGGTGCTCTGCTTTGTGAAAATTTGTGGATGATGATGGCTAACAATGTGGTGTTCTTGGTTGCAGATATGCAGGCCTCCGATGAACGGCCAGAGCGGCCTCCTCCGGGCTGACTG
CATGTCCATGGAGCACCATTCAAG
GTGCGCTTTTTTTCCCCGGAATTTTGAACAAATTTTTAGTTTTTGAGATGAATTCGCTCCAATGATTTGTTCTTTTGAAAAAAAGGGAGTAAAATT
TAAAAACCTACAACTATTTTTTGTCAAAATTACCAATTTGCTGCAATTTCAAAATTCAGAAAACAACAACATTTTTTTTGTCAAATTAGATATTTGCCACAATTTCAGCTTGGCCAATTC
AAGAGGACAACAACAATAATGCACGACTTTACCTGTAAGCCGGCCCTTTCAAAAATGATTTTGTCAGAGAGCTACAATAATACCTAAAGTCGCCCGAATAATTGCTGCTTTACGAAATTT
ACTCCAAAAAAAATCATTCTGATTCCATTTTGACATTTGACATTTCAAAAACGATTTTATCATAAAGCTACAATAATACCTAAACTTATTCAAATAATTGCAATTTTTTTTGGGTGAAAT
TTGCTCGAAATATGAACTCAAATTTTGGCATCTTGTGCAGGTTCCCCAAGCTCCTGATCGACGGGCCGTACGGCGCGCCGGCGCAGGACTACTGGAAGTACGACGTCCTCCTCCTCATCG
GCCTAGGCATCGGCGCCACCCCTCTCATCAGCATCGTCAAGGACGTCCTCAACCACATCTACGACGACCCCGAGTCCGCCGCCTCGCCGCACACCACCAATGGCGGCGGCGCCGCGGCCG
CGGCGAGGAGGGCGTTCATGACGAAGCGCGTCTACTTCTACTGGTGCACGCGGGAGGAGGGCTCGTTCGAGTGGTTCCGCGGCGTGATGAACGAGGTGGCCGACCGCGACGCCGGGCGCG
AGTTGATCGAGCTCCACAACCACTGCACCAGCGTGTACGAGGAGGGGGACGCGCGGTCGGCGCTGGTGACGATGCTCCAGGCGCTCCACCACGCCAAGAACGGCGTGGACGTGGTGTCCG
GGACGCGGGTGCGCACCCACTTCGCGCGCCCGAGCTGGCGCGACGTGTTCAAGCGCGTCGCCGTGAACCACCAGGGGCAGCGCGTCGGCGTCTTCTTCTGCGGCGACCAGGCGCTCACGC
CGGAGCTCCGCCGCCTCGCCCAGGACTTCTCCCACAAGACCACCACCAAATTCGTCTTCCACAAGGAGAATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGAGCCGGGAGGAGAGCGGCAATGGCGGTGGCGGTGGCGCGACGCCGGCGGCGGATTACCGGAGCTCGGACAGCCGGAGCTCGAGCCGGCGGAGCACGCGGTTCAAGGAGGACAACG
AGTACGTGGAGATCACGCTCGACGTCAAGGGCGACGACACGGTCGCCATCCAGAGCATCCGCAACGGCGCCGACATGCCCGAGGTCGCCCTCCTCGCGCGCGGCCTCGCGCAGCAGCCGC
CGCCGTCCGCGGCGCCCGGCCCCGGCGGGCTCTCGTCGCGGCTCAAGGCGGTGAGGACCGAGCTGAGGCGGATCGCGTCGTGGAAGTTCCCCAGCGGCGTTCTCAGCGGCGGCGGCGGCG
GCGGCGACGCGCCGGGCAACGGCAACGACCGCCGCCCTCGCCTCGACCGGAGCATGACCGGCGCCGCCCGCGCGCTGCGCGGGCTCCAGTTCCTCAACTCCAGCGCCGTCACCAATGGCT
GGCCGGAGGTGGAGAAGAGGTTCGAGCGCCTCGCCGTCGACGGCTTCCTCCTCCGCTCCCGCTTCGGCCAGTGCATCG
GAATGGTTGGATCCGAGGAGTTTGCGGTTCAGATCTTCGACT
CGCTTGCGCGGCGGCGAGGGATCACGGCTCAGTTGCTGACCAAGGATCAGCTCCGGGAGTTTTGGGAGCAGCTCTCTGATCCAGGATTTGATGCCAAGCTGCAGACTTTCTTTGACAT
GG
TTGACAAGAATGCAGATGGTCAGATCACTGAAGAGGAGCTCAAAGAG
GTCCTCACCCTGACTGCCTCTGCAAACAAGCTGTCCAAGATCCTGGAGCGCGTCGACGAGTACACCGCGCTGA
TCATGGAGGAGCTCGATCCCGATCAATTAGGCTACATAGAT
ATATCAAACCTGGAGTCGCTGCTGCTGCTGCCGCCGTCGCAGGCGCCGTCGAAGCTGGTGACGCACAGCTCCAACATCA
GCCAGCTGATCAGCCAGAAGCTGGTGCCGACGCACGACCGGAACCCGCTCCGGCGGGGGCTCCGGCGGCTGTCCTACTTCATGGAGGACAACTGGAAGCGGGTGTGGGTGATGGCGCTGT
GGCTGGCCATCAACGCCGGCCTCTTCACCTGGAAGTTCATGGCGTACAAGCGCCACCCGACGTTCGACGTCATGGGCTACTGCGTCTGCGTCGCCAAGGGCGGTGCCGAGACCACCAAGT
TCAACATGGCCCTCATCCTCCTCCCCGTTTGCCGGAACACCATCACCTGGCTCCGTTCTCGCACCAAGCTCGGCGCCGTCATCCCCTTCAATGACAACATCAACTTCCACAAG
GTGGTGG
CAGGGGGAGTGGTGGTAGGGGTGGCGCTGCACGGGGTGACTCACCTGACGTGCGACTTCCCGAGGCTGCTGCACGCGAGTGATGCGGCGTACGAGCCGATGAAGAAGTACTTCGGGCAGA
CACGGATCCCGGACTACTGGTGGTTCGTGCGCGGCGTAGAGGGGATCACCGGCGTGATCATGGTGGTGCTCATGGCCATCGCCTACACGCTGGCGCACCCGTGGTTCCGCCGGAGCAAGC
TTAGTGACAGCAACCCGCTGAAGCGGCTCAGCGGTTTCAATATGTTTTGGTACTCCCACCACCTCTTCGTCATCGTCTACATCGCCTTCGTTGTCCATGGCGTCTGCCTCTACATCAACC
GGACTTGGTGGAAGCAGACG
ACATGGATGTACCTTGCCATCCCTATCCTGCTCTACGCCGGTGAGCGGATTTTCCGGGCTCTGAGGTCTCATGGCTTCACCACCGTAAGGATTGAGAAGG
TTGCAATCTATCCTGGCAACGTGATAGCCATCCACATGACCAAGCCCCATGGGTTCAAGTACAAGAGTGGCCAGTACATCTATGTTAACTGCGGCGAGGTCTCGCCATTCGAGTG
GCACC
CGTTCACCATCACCTCGGCTCCCGACGACAGCTATCTCAGCATGCATATCCGGTGCCGCGGTGACTGGACCTCGAGCTTCAGGGCCATCTTCTCTCAG
ATATGCAGGCCTCCGATGAACG
GCCAGAGCGGCCTCCTCCGGGCTGACTGCATGTCCATGGAGCACCATTCAAG
GTTCCCCAAGCTCCTGATCGACGGGCCGTACGGCGCGCCGGCGCAGGACTACTGGAAGTACGACGTCC
TCCTCCTCATCGGCCTAGGCATCGGCGCCACCCCTCTCATCAGCATCGTCAAGGACGTCCTCAACCACATCTACGACGACCCCGAGTCCGCCGCCTCGCCGCACACCACCAATGGCGGCG
GCGCCGCGGCCGCGGCGAGGAGGGCGTTCATGACGAAGCGCGTCTACTTCTACTGGTGCACGCGGGAGGAGGGCTCGTTCGAGTGGTTCCGCGGCGTGATGAACGAGGTGGCCGACCGCG
ACGCCGGGCGCGAGTTGATCGAGCTCCACAACCACTGCACCAGCGTGTACGAGGAGGGGGACGCGCGGTCGGCGCTGGTGACGATGCTCCAGGCGCTCCACCACGCCAAGAACGGCGTGG
ACGTGGTGTCCGGGACGCGGGTGCGCACCCACTTCGCGCGCCCGAGCTGGCGCGACGTGTTCAAGCGCGTCGCCGTGAACCACCAGGGGCAGCGCGTCGGCGTCTTCTTCTGCGGCGACC
AGGCGCTCACGCCGGAGCTCCGCCGCCTCGCCCAGGACTTCTCCCACAAGACCACCACCAAATTCGTCTTCCACAAGGAGAATTTCTAG

Retrieve as FASTA