Entry information : OsRboh04(LOC_Os05g38980 / OsNox04 / OsRbohD)
Entry ID 5568
Creation 2007-07-19 (Christophe Dunand)
Last sequence changes 2007-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-28 (Christophe Dunand)
Peroxidase information: OsRboh04(LOC_Os05g38980 / OsNox04 / OsRbohD)
Name OsRboh04(LOC_Os05g38980 / OsNox04 / OsRbohD)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Flowers
Inflorescences
Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh04
start..stop
S start..stop
ZmRboh09 1454 0 19..819 20..822
SbRboh04 1440 0 24..819 28..827
SbRboh05 1352 0 8..819 29..854
OsRboh03 1335 0 24..819 37..843
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22715144..22715444 301 N° 2 22716245..22716407 163 N° 3 22716484..22716532 49 N° 4 22716626..22716739 114
N° 5 22716812..22717234 423 N° 6 22717307..22717693 387 N° 7 22717777..22717872 96 N° 8 22717978..22718093 116
N° 9 22718170..22718272 103 N° 10 22718392..22718480 89 N° 11 22718586..22718736 151 N° 12 22718817..22718966 150
N° 13 22719057..22719185 129 N° 14 22719276..22719354 79 N° 15 22719435..22719544 110  
join(22715144..22715444,22716245..22716407,22716484..22716532,22716626..22716739 ,22716812..22717234,22717307..22717693,22717777..22717872,22717978..22718093,227 18170..22718272,22718392..22718480,22718586..22718736,22718817..22718966,2271905 7..22719185,22719276..22719354,22719435..22719544)


exon

Literature and cross-references OsRboh04(LOC_Os05g38980 / OsNox04 / OsRbohD)
Literature IRGSP(International Rice Genome Sequencing Project). Oryza sativa nipponbare(GA3) genomic DNA, chromosome 5. Submitted (FEB-2005) to the EMBL/GenBank/DDBJ databases.
DNA ref. GenBank:   NC_008398.1 (22715144..22719541)
mRNA ref. GenBank:   AK072353
Cluster/Prediction ref. UniGene:   Os.53380
Protein sequence: OsRboh04(LOC_Os05g38980 / OsNox04 / OsRbohD)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   819
PWM (Da):   %s   92143.25 Transmb domain:   %s   o268-287i401-423o449-471i636-653o
PI (pH):   %s   9.42
Sequence 860
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGDYVDVPLGGGGQSTLPPVAPLKKQPSRLASGMKRLASMVPDTMKLKRTHSSAQPALRGLRFLDKTSAGKDGWKNVEKRFDEMSADGRLPQESFAKCIGMADSKEFASEVFVALARRRSIKPEDGITKEQLKEFWEELTDQNFDSRLRIFFDMCDKNGDGQLTEDEVKEVIVLSAAANKLAKLKSHAATYASLIMEELDPDHRGYIEIWQLETLLRGMVTAQGPPEKVKLASASLARTMVPSSHRSPMQRRFNKTVDFIHENWKRIWVLSLWAILNIALFMYKFVQYSRRDAFQVMGYCVCIAKGAAETLKLNMAVILLPVCRNTLTRLRSTALSKVVPFDDNINFHKVIALTIAIGAATHTLAHVTCDFPRLVSCPRDKFEATLGPYFNYVQPTYSSLVASTPGWTGILMILIMSFSFTLATHSFRRSVVKLPSPLHHLAGFNAFWYAHHLLVIAYILLVLHSYFIFLTKQWYNRTTWMFLAVPVLFYSCERTIRRVRESSYGVTVIKAAIYPGNVLSIHMNKPSSFKYKSGMYMFVKCPDVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTTELRNLFGKACEAQVSSKKATLARLETTIIADGLKEETCFPKVFIDGPFGAPAQNYKKYDILLLIGLGIGATPFISILKDLLNNIKSNGDVQSTHDAELGCTFKSNGPGRAYFYWVTREQGSFEWFKGVMNDVAESDHDNVIEMHNYLTSVYEEGDARSALIAMVQSLQHAKNGVDIVSGSKIRTHFARPNWRKVFSDLANAHQNSRIGVFYCGSPTLTKMLRDLSLEFSQTTTTRFHFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, introns), 2 mRNA and 17 ESTs. four SwissProt/TREMBL accessions: Q0DHH6 (DNA), A3BUB0 (uncorrect prediction confirmed with ESTs), Q6I5J8 (Partial prediction, 3' missing), Q6I5U1 (Partial prediction, 3' missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGGGGACTACGTGGACGTGCCGCTGGGCGGCGGCGGGCAGAGCACGCTGCCGCCGGTGGCGCCGCTGAAGAAGCAGCCGTCGCGGCTGGCGTCCGGGATGAAGCGGCTGGCGTCCA
TGGTGCCCGACACGATGAAGCTGAAGCGGACGCACTCCAGCGCGCAGCCGGCGCTGCGCGGCCTGCGCTTCCTCGACAAGACGTCGGCGGGGAAGGACGGGTGGAAGAACGTCGAGAAGC
GGTTCGACGAGATGAGCGCCGACGGACGCCTGCCCCAGGAGAGCTTCGCCAAATGCATCG
GTGAGTGCTCCTGCACATGCCCCCATGGTGTTCTCCATCCTCCAAAGTGATTAGTGATTC
ACCACAGCATGAAAAGAGAGACGGTGAAATTGCATTGTTAGCAAGAACACATCGAAAATTGACAAGCTTTGTTTTCCCTGCAAAAAAAAAAGGGGAAAATGTTGTCAAAGCTTTTGTGCA
TGTGATGGAAAAAGGGGAACAGTTAGTAGATGAGAAATTGGTACAGATCATTCCTAGCTCGTATGTCGATGGTGTTTGTCCAAAATTTCAGCCATTTCAACTGTTTAAGCAGCCAGCCTC
CTCCTGCCATCCATGCATACATGTTTGCAGCACTTCTTTGATAAAGTATACATAATCATTCCTATTCACAATTTTATTTTAACAAAAAACGGAGGAAAGAAAATTGGAAAATTTAAGAGG
ATATAATTGGTCGACCACGGGTTGCACAAAGTTCAGACTTTGGCCCCCCCAAATATAACTCGGAGACAATACTTACCACGTAGCAAGAATAGGATATACTTCCTCCGTTTCATAATGTAA
GACTTTCAATCATTGCCCACATTCATATAGATGTTAATGAATCTAGACATATATATATGTGTATAGATTCATTAACATCTATATGAATATGGGCAATGCTAGAAAGTCTTACAATATGAA
ACGGAGGGAGTACTCGTGCTTACGACATTTTCTTTTAAAAGAAGTGTAGTCAGGTAAATAAATGACATCAGAATAGCAATAAATCCATCCTCTGTATATAAATTGAAGCTCTAAGCTTAG
AATGCCTCTGCAACTTAAAGGTATGGCGGATTCTAAGGAGTTTGCAAGCGAGGTGTTTGTGGCATTGGCGAGAAGGAGGAGCATCAAACCAGAAGATGGGATAACAAAGGAACAGCTGAA
AGAATTTTGGGAGGAGTTGACTGATCAGAACTTTGATTCACGACTACGAATATTCTTTGACAT
GTAAAGGTCTACCTTCCTTGTCTTCAATGGAAAAAACCTTATGACTTGCCCCTTGAT
GAGATTGCTTTGCAATCAGGTGTGACAAGAATGGTGATGGGCAGCTTACAGAGGACGAGGTCAAAGAGGTCAGTTCCCAATCATCTCTGAATTTACCTTTTTTCCACAAAGCTTGTGGAA
ATGATCTCAATAAGAATTTACCTTTCTCTTTCCATATGCAGGTTATTGTGTTGAGTGCCGCAGCAAACAAACTTGCCAAGTTGAAAAGCCATGCTGCAACCTACGCCTCACTGATCATGG
AAGAGCTGGATCCTGATCATCGCGGTTACATTGAG
GTACCAAGACATGAAATTATCTCCCTTTTTTTTGACAAACAGCAGCATACAGATATGCTTGTCTCAATGCAGATTTGGCAGCTGG
AGACGCTACTCCGTGGTATGGTGACAGCCCAAGGGCCTCCAGAGAAGGTGAAGCTGGCTTCAGCAAGCCTTGCAAGGACAATGGTCCCTTCCAGTCACCGGAGTCCAATGCAGAGGCGTT
TCAACAAGACTGTTGACTTCATCCATGAGAATTGGAAGAGGATATGGGTGCTCTCCTTGTGGGCGATCCTCAATATTGCATTATTCATGTACAAGTTTGTGCAGTACAGTAGGCGGGATG
CATTTCAGGTGATGGGCTACTGTGTCTGCATAGCAAAGGGTGCTGCCGAAACACTCAAGCTGAACATGGCCGTTATACTCCTCCCGGTGTGCCGAAACACACTAACAAGGCTCCGATCAA
CAGCACTCAGCAAAGTCGTACCATTTGATGATAACATAAACTTCCACAAG
GTACACGTGTGGAACTCTTTGCCATTTCCAGGATTACACAGCCTGACCTCTTTGTTCTGATCACCATATC
AGGTTATCGCACTGACGATTGCAATTGGAGCGGCTACTCATACTCTTGCTCATGTAACCTGCGACTTCCCAAGATTGGTATCATGTCCAAGGGACAAGTTCGAGGCCACACTGGGGCCTT
ACTTCAACTATGTTCAACCAACATACTCATCGCTGGTTGCAAGCACTCCAGGGTGGACTGGCATCCTCATGATCTTGATAATGTCATTCTCGTTCACACTTGCGACACATTCGTTCAGGA
GGAGCGTTGTGAAGCTTCCATCACCACTGCACCACCTTGCTGGTTTCAATGCCTTTTGGTACGCCCATCACCTACTGGTGATTGCATATATCCTCTTGGTGCTGCACTCCTACTTCATAT
TTCTCACCAAGCAGTGGTACAATCGAACG
GTATTTCTCTGGCATATGTTTGGCACAACTATTTCTTTTGTGAATTCAGTGGTTGTGCATAATATTGACGCTTGTGTTTACAGACGTGGAT
GTTCTTGGCAGTTCCAGTCCTCTTTTACTCCTGCGAGAGAACTATCAGAAGAGTTCGTGAGAGCAGTTATGGGGTGACCGTCATCAAG
GTAAGCAACATATTTCACATGAATTGCACGAT
GAGTATTTTCAATTTATTCTAGCTTCTAAGTGTACAAGAATACCATTAATTGACTATCAAATGTGCCATGCAGGCAGCAATTTACCCTGGAAATGTGCTCTCTATTCACATGAATAAACC
ATCAAGTTTCAAGTACAAAAGTGGGATGTATATGTTTGTAAAATGCCCAGATGTTTCGCCTTTTGAATG
GTACCATCTGATCGTCTCTGTCCAAATGTCAGTGTTTATCCAGGCTATGGA
TTAATAGATTCTTCAATGCTTCCAGGCATCCCTTCTCCATAACTTCTGCACCTGGAGATGACTACTTGAGTGTTCATATCCGTACATTAGGTGACTGGACAACAGAACTTAGAAACCTAT
TTGGGAAG
GTCAGTTGAGCAAACAGAAACAAAAAGAAAAGGAGAATAGTTCAGGCATAATGGGAGCTTATGCAGTATTTATATGCTAAATTAACAAAGTTGCTAAAGGGTTATGCTAATT
CATGCAGGCTTGTGAGGCACAAGTAAGTTCCAAGAAGGCTACACTTGCACGACTTGAAACCACTATCATAGCAGATGGTCTGAAAGAGGAGACTTGGTAATTATGCCCTGTTTGTTTCAT
ATTCTACATTCATCTACTTTTTGAAGGAATTTCTATACAATTGTTTCACTAATCTTCCTGACTTTGGTTCTCTTCATTTAGCTTTCCCAAAGTCTTTATAGATGGTCCTTTCGGCGCACC
AGCTCAAAATTACAAGAAATATGACATTCTTTTGCTTATCGGGCTTGGAATTGGAGCAACGCCTTTCATCAGCATACTGAAGGATCTCCTGAACAACATAAAATCCAATGGA
GTAAACTG
CTTAACTATAGCAAATTCTTTCTTATACAGTAAACCAAGTGCATAATATCTAAAGTGAATTGGATTCAACAGGATGTGCAAAGCACGCATGATGCTGAGTTAGGCTGCACCTTTAAGAGC
AATGGGCCAGGAAGAGCTTATTTCTACTGGGTCACCAGAGAGCAAGGTTCCTTTGAATGGTTTAAAGGCGTGATGAATGATGTTGCTGAAAGTGATCATGAT
GTACTACTCAGTCTAACT
GCTTCAGTGCAACTTCCATGTTCTCTCCTTCAGATTAATAAATAGATACTAACATAATCACTCACTATACAGAATGTAATAGAGATGCACAATTACCTGACAAGCGTGTATGAAGAAGGA
GATGCAAGATCAGCTCTGATTGCCATGGTCCAATCACTTCAACATGCCAAAAATGGTGTGGATATCGTCTCTGGCAGCAAG
GTTTTTCCCACTTCTATCCTCCTGCAAAAATAAAAATAA
AAACTAAATCACATGTGCAAAATTTGATTCAATATTTCTCGCTTTATGCAGATCCGGACACATTTTGCAAGGCCGAACTGGAGAAAGGTATTCTCAGATCTGGCCAATGCCCACCAGAAC
TCTCGTATAG
GTCAGTTCTATGTGATAAATCTCAAGTGATGGTTCCTAGTTTACAGGATAGCAATGCTGAGATGTTTCATAAATCTGCAGGCGTTTTCTACTGTGGGTCTCCAACACTTA
CGAAAATGCTGAGGGATCTTTCACTAGAATTCAGCCAGACGACAACGACTCGGTTCCATTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGGGGACTACGTGGACGTGCCGCTGGGCGGCGGCGGGCAGAGCACGCTGCCGCCGGTGGCGCCGCTGAAGAAGCAGCCGTCGCGGCTGGCGTCCGGGATGAAGCGGCTGGCGTCCA
TGGTGCCCGACACGATGAAGCTGAAGCGGACGCACTCCAGCGCGCAGCCGGCGCTGCGCGGCCTGCGCTTCCTCGACAAGACGTCGGCGGGGAAGGACGGGTGGAAGAACGTCGAGAAGC
GGTTCGACGAGATGAGCGCCGACGGACGCCTGCCCCAGGAGAGCTTCGCCAAATGCATCG
GTATGGCGGATTCTAAGGAGTTTGCAAGCGAGGTGTTTGTGGCATTGGCGAGAAGGAGGA
GCATCAAACCAGAAGATGGGATAACAAAGGAACAGCTGAAAGAATTTTGGGAGGAGTTGACTGATCAGAACTTTGATTCACGACTACGAATATTCTTTGACAT
GTGTGACAAGAATGGTG
ATGGGCAGCTTACAGAGGACGAGGTCAAAGAG
GTTATTGTGTTGAGTGCCGCAGCAAACAAACTTGCCAAGTTGAAAAGCCATGCTGCAACCTACGCCTCACTGATCATGGAAGAGCTGG
ATCCTGATCATCGCGGTTACATTGAG
ATTTGGCAGCTGGAGACGCTACTCCGTGGTATGGTGACAGCCCAAGGGCCTCCAGAGAAGGTGAAGCTGGCTTCAGCAAGCCTTGCAAGGACAA
TGGTCCCTTCCAGTCACCGGAGTCCAATGCAGAGGCGTTTCAACAAGACTGTTGACTTCATCCATGAGAATTGGAAGAGGATATGGGTGCTCTCCTTGTGGGCGATCCTCAATATTGCAT
TATTCATGTACAAGTTTGTGCAGTACAGTAGGCGGGATGCATTTCAGGTGATGGGCTACTGTGTCTGCATAGCAAAGGGTGCTGCCGAAACACTCAAGCTGAACATGGCCGTTATACTCC
TCCCGGTGTGCCGAAACACACTAACAAGGCTCCGATCAACAGCACTCAGCAAAGTCGTACCATTTGATGATAACATAAACTTCCACAAG
GTTATCGCACTGACGATTGCAATTGGAGCGG
CTACTCATACTCTTGCTCATGTAACCTGCGACTTCCCAAGATTGGTATCATGTCCAAGGGACAAGTTCGAGGCCACACTGGGGCCTTACTTCAACTATGTTCAACCAACATACTCATCGC
TGGTTGCAAGCACTCCAGGGTGGACTGGCATCCTCATGATCTTGATAATGTCATTCTCGTTCACACTTGCGACACATTCGTTCAGGAGGAGCGTTGTGAAGCTTCCATCACCACTGCACC
ACCTTGCTGGTTTCAATGCCTTTTGGTACGCCCATCACCTACTGGTGATTGCATATATCCTCTTGGTGCTGCACTCCTACTTCATATTTCTCACCAAGCAGTGGTACAATCGAACG
ACGT
GGATGTTCTTGGCAGTTCCAGTCCTCTTTTACTCCTGCGAGAGAACTATCAGAAGAGTTCGTGAGAGCAGTTATGGGGTGACCGTCATCAAG
GCAGCAATTTACCCTGGAAATGTGCTCT
CTATTCACATGAATAAACCATCAAGTTTCAAGTACAAAAGTGGGATGTATATGTTTGTAAAATGCCCAGATGTTTCGCCTTTTGAATG
GCATCCCTTCTCCATAACTTCTGCACCTGGAG
ATGACTACTTGAGTGTTCATATCCGTACATTAGGTGACTGGACAACAGAACTTAGAAACCTATTTGGGAAG
GCTTGTGAGGCACAAGTAAGTTCCAAGAAGGCTACACTTGCACGACTTG
AAACCACTATCATAGCAGATGGTCTGAAAGAGGAGACTTG
CTTTCCCAAAGTCTTTATAGATGGTCCTTTCGGCGCACCAGCTCAAAATTACAAGAAATATGACATTCTTTTGCTTATCG
GGCTTGGAATTGGAGCAACGCCTTTCATCAGCATACTGAAGGATCTCCTGAACAACATAAAATCCAATGGA
GATGTGCAAAGCACGCATGATGCTGAGTTAGGCTGCACCTTTAAGAGCA
ATGGGCCAGGAAGAGCTTATTTCTACTGGGTCACCAGAGAGCAAGGTTCCTTTGAATGGTTTAAAGGCGTGATGAATGATGTTGCTGAAAGTGATCATGAT
AATGTAATAGAGATGCACA
ATTACCTGACAAGCGTGTATGAAGAAGGAGATGCAAGATCAGCTCTGATTGCCATGGTCCAATCACTTCAACATGCCAAAAATGGTGTGGATATCGTCTCTGGCAGCAAG
ATCCGGACAC
ATTTTGCAAGGCCGAACTGGAGAAAGGTATTCTCAGATCTGGCCAATGCCCACCAGAACTCTCGTATAG
GCGTTTTCTACTGTGGGTCTCCAACACTTACGAAAATGCTGAGGGATCTTT
CACTAGAATTCAGCCAGACGACAACGACTCGGTTCCATTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA