Entry information : GmPrx63 (Glyma11g29890.1)
Entry ID 562
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx63 (Glyma11g29890.1)
Name (synonym) GmPrx63 (Glyma11g29890.1)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Sudden Death Syndrome disease
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx63
start..stop
S start..stop
GmPrx330 612 0 1..320 1..320
GmPrx74 522 0 1..320 1..320
GmPrx249 519 0 1..320 1..319
RcPrx52 486 3e-175 1..320 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30772593..30772811 219 N° 2 30773423..30773614 192 N° 3 30774151..30774316 166 N° 4 30774669..30775054 386
join(30772593..30772811,30773423..30773614,30774151..30774316,30774669..30775054 )


exon

Literature and cross-references GmPrx63 (Glyma11g29890.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm11 (30772593..30775054)
Protein sequence: GmPrx63 (Glyma11g29890.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (294)
PWM (Da):   %s   34018.66 (30933.1) Transmb domain:   %s   i7-26o
PI (pH):   %s   6.11 (5.69) Peptide Signal:   %s   cut: 27 range:27-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFYSLRYNVFCFSILFSLLIAIASADLSSDFYASTCPNALSTIKSAVKSAVAKERRMGASLLRLHFHDCFVNGCDASVLLDDTSSFTGEKSAAANLNSLRGFDVIDDIKSQLESSCPGIVSCADIVAVAARDSVVALGGPSWTIGLGRRDSTAASKEAATSDIPSPLMDLSDLISAFSNKGFTSKEMVVLSGAHTTGQAKCQFFRGRIYNETNIDSDFATSAKSNCPSTDGDSNLSPLDVTTNVLFDNAYFKNLVNKKGLLHSDQQLFSGGSTDSQVTTYSTSSSTFYADFASAMVKMGNLSPLTGSSGQIRTNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTTCTATTCACTACGTTATAACGTGTTTTGCTTCTCTATTTTGTTTTCTCTACTTATTGCCATAGCCTCTGCTGATCTATCTTCAGATTTCTATGCATCAACATGCCCCAATGCC
CTCTCTACCATAAAATCTGCAGTGAAAAGTGCAGTTGCTAAAGAGCGTCGCATGGGGGCATCCTTGCTCCGTCTTCATTTCCATGATTGCTTTGTTAAT
GTACGTTCTTTCTTCTCTAAC
ACTCTTCATCTGTTTCACTCTCTGACTCATGGATGAAGTGCACGTATATTCACACACGTATGACTTACATACAAAATATATAGGAAAAAAAAACAACTTAGATTCTCACTTGAGATTTTT
TTTGTAATTATAAGATCTTGTTTCCTTTTTCCATTTGTGTGTCGTTAATACTATGATATTAGATGCATTAGTTTTTGTTATACATGTATAGGGAGAAATTCAGATATAGTCTTAAACCAC
ATGATTCGCAATAATCTTCACAATATATGTAATCAAATATTATTAGAGTCCAATGAGTAAGCACCGATGATAATTTAAAATAATTTTTATATTATCATTTACTCATATTTTTAGTATGAA
TTTTATGATAATTATTATAAAAATTAATAACATTATCATACATTGTAATTCATAATATTAAATAATATTTTAAAATTGTTTTACATTAATCTTTTTTGTAAATTAAAAAATTTAAATACT
TATGGTATAAAAATTGGACTTGGTCAAGGAATAGAATGTAGCTAGCTAGTATGAGTTTCCATGCATTACACATTATGTGTTCAACAATTGATTGTTAATGAAACCTGTAGGGATGTGATG
CATCAGTTCTTCTAGATGACACTTCGAGCTTCACGGGAGAAAAGTCAGCTGCTGCAAATTTGAATTCTTTAAGGGGTTTTGATGTAATTGACGACATCAAAAGTCAGTTGGAGAGTTCTT
GTCCGGGGATTGTTTCCTGTGCAGATATTGTTGCTGTTGCTGCACGAGATTCTGTCGTAGCT
GTAAGTTAATTTATTTAATACAATAACCAGTATGAAATATAAAAAACAAGATAAATTA
ATAAACAAAAAAAATCACCATCTATATATAGTAATGTAAAAATATCAGTATTTCTATGTTTAAAATGAAAAAAAAAATGTCTTGTAATATGTAGAATAGGAACATTAATAGACATCTTCA
AATTTTTATCACAAAATATTCATATCTTGAAAATCTCCCTCAACACCAGCAACTTATCGATAAAACTCTAAAACGAAATTTTCTTTTAATCCTTATCATTTAGGAAAACATCAAAATTTC
ATGATAACAAATATTTTCTATAATTTTATGTTAATTTAAGAGTAAATAATCTATATATTGATAATGTGAATAAATTTTATATTTTTATTCAATTATAAATTGAGATAAAGTGAGTTAATT
TGTTAACTTTTCTAATAATTTTTTAGTGTAATTGATAATCCAACTTTTTCACATTAAGATACATGCATAGATATTAATTTGAAGTATTATTAACTGACTGGTATTTTCATTATCTCAGTT
GGGTGGTCCATCATGGACAATAGGGTTAGGCAGAAGAGATTCAACCGCTGCAAGTAAAGAGGCTGCCACTAGCGATATTCCATCCCCTCTAATGGACCTTAGTGATCTCATATCAGCTTT
TTCAAATAAGGGGTTTACCTCCAAAGAGATGGTAGTCCTCTCAG
GTAAATTCAAAACACTTTTTTAATTAAAAATAAATAAAATCCAATTCTCAAAGACTTCCATTGGCATCTAATTAAT
TAATGGAAAAAGGTAACCAATACCCTTAAGGCATAGTTAAGAGATTAAAATGAGTACTTTTTTTATTAAAAGGCATAAAATTATATTATGTATGAATTTTTTATGTTTTCTTATAATTTT
CATAATAAATATTTTTTCNNNNNNNNNNNNNNNNNNNNNNNNTAAAAATATTAGTTAGCAAAACCCTTAATGAATTTACCTCATAACTAAGATTATGCAACAAAATCTTTTCTTATCTTA
AAATTCGTGTACTTGTGTGTGTATATATATATATAGGAGCTCATACAACAGGGCAAGCCAAATGCCAATTCTTCCGGGGTAGGATCTACAATGAGACCAACATTGATTCAGATTTTGCAA
CATCAGCCAAGTCAAATTGTCCAAGCACTGATGGTGACAGCAACCTCTCCCCACTAGATGTCACCACCAATGTGTTATTTGACAATGCTTATTTCAAGAACCTAGTCAACAAGAAAGGGC
TTCTCCATTCTGATCAGCAACTTTTTAGTGGCGGTTCTACTGATTCTCAGGTCACTACCTACAGCACCAGCTCTTCAACTTTCTATGCAGACTTTGCCAGTGCCATGGTCAAAATGGGAA
ATCTCAGCCCTTTAACAGGAAGCAGTGGCCAAATTCGTACTAACTGCCGCAAAGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTTCTATTCACTACGTTATAACGTGTTTTGCTTCTCTATTTTGTTTTCTCTACTTATTGCCATAGCCTCTGCTGATCTATCTTCAGATTTCTATGCATCAACATGCCCCAATGCC
CTCTCTACCATAAAATCTGCAGTGAAAAGTGCAGTTGCTAAAGAGCGTCGCATGGGGGCATCCTTGCTCCGTCTTCATTTCCATGATTGCTTTGTTAAT
GGATGTGATGCATCAGTTCTT
CTAGATGACACTTCGAGCTTCACGGGAGAAAAGTCAGCTGCTGCAAATTTGAATTCTTTAAGGGGTTTTGATGTAATTGACGACATCAAAAGTCAGTTGGAGAGTTCTTGTCCGGGGATT
GTTTCCTGTGCAGATATTGTTGCTGTTGCTGCACGAGATTCTGTCGTAGCT
TTGGGTGGTCCATCATGGACAATAGGGTTAGGCAGAAGAGATTCAACCGCTGCAAGTAAAGAGGCTGCC
ACTAGCGATATTCCATCCCCTCTAATGGACCTTAGTGATCTCATATCAGCTTTTTCAAATAAGGGGTTTACCTCCAAAGAGATGGTAGTCCTCTCAG
GAGCTCATACAACAGGGCAAGCC
AAATGCCAATTCTTCCGGGGTAGGATCTACAATGAGACCAACATTGATTCAGATTTTGCAACATCAGCCAAGTCAAATTGTCCAAGCACTGATGGTGACAGCAACCTCTCCCCACTAGAT
GTCACCACCAATGTGTTATTTGACAATGCTTATTTCAAGAACCTAGTCAACAAGAAAGGGCTTCTCCATTCTGATCAGCAACTTTTTAGTGGCGGTTCTACTGATTCTCAGGTCACTACC
TACAGCACCAGCTCTTCAACTTTCTATGCAGACTTTGCCAGTGCCATGGTCAAAATGGGAAATCTCAGCCCTTTAACAGGAAGCAGTGGCCAAATTCGTACTAACTGCCGCAAAGTTAAC
TAA

Retrieve as FASTA