Entry information : GmPrx79 (Glyma06g28890.1)
Entry ID 578
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-10-12 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx79 (Glyma06g28890.1)
Name (synonym) GmPrx79 (Glyma06g28890.1)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx79
start..stop
S start..stop
LjPrx51 545 0 1..321 1..322
GmPrx320 545 0 6..321 5..320
PpePrx26 535 0 9..321 9..321
MtPrx66 528 0 6..321 5..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27377756..27377956 201 N° 2 27376968..27377147 180 N° 3 27376314..27376476 163 N° 4 27375659..27376083 425
complement(join(27375659..27376083,27376314..27376476,27376968..27377147,2737775 6..27377956))


exon

Literature and cross-references GmPrx79 (Glyma06g28890.1)
Literature Vodkin,L. et al, A Functional Genomics Program for Soybean.
Shoemaker,R et al, Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm06 (27377956..27375659)
Protein sequence: GmPrx79 (Glyma06g28890.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (303)
PWM (Da):   %s   34956.55 (32813.5)  
PI (pH):   %s   6.99 (6.88) Peptide Signal:   %s   cut: 21 range:21-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGHTWLGSLVIFMTISAVQAQLKTGFYSSSCPNAEATVRSTVESYFNKDPTIAPGLLRLHFHDCFVEGCDGSVLISGSSAERNALANTGLRGFEVIEDAKSQLEAKCPGVVSCADILALAARDAVDLSDGPSWSVPTGRRDGRVSLSSQASNLPSPLDSISVQRKKFADKGMDDHDLVTLVGAHTIGQTECRFFSYRLYNFTTTGNSDPTIDQNFLGQLKTLCPNIGDGLRRVSLDKDSPAKFDVSFFKNVRDGNAVLESDQRLWGDSNTQSIVQSYAGNIRGLLGIRFDYEFRKAMVKLGGVEVKTGSQGEIRKVCSKVNR

Retrieve as FASTA  
Remarks Complete sequence from genomic and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACACACATGGTTGGGTTCATTAGTGATTTTTATGACAATTTCGGCCGTACAAGCCCAACTCAAAACTGGGTTTTACTCCTCTTCGTGCCCAAACGCAGAAGCCACAGTTCGATCC
ACTGTTGAATCCTACTTCAATAAAGATCCTACAATTGCTCCTGGCCTGCTCCGACTTCATTTCCATGATTGCTTTGTCGAG
GTTTGCTACTTTGATCTTCATCTTTCACTCACATAATAA
ATAATGTACTACAATTGTTTGGCATATTTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCTTTATTTTAACTCTCAGTTACT
AACTAACTTTCTTGTGCCTTATAACTAATTTTTTGGTTTTCAATTAGTTTTGTTGAACACATGATTGTCATACCACATATTTATTTTGATATAGAAGTTCTTTATTTAGTTATGTCGCTG
TATTTAATATCAATTAGATATAATTTAATTAATTGAATAAGATGTATGAGTTATTATAAATATAGATTTTGTGTTATTTTTTCCCACAGGGCTGCGATGGTTCAGTTTTGATTTCAGGCT
CTTCTGCGGAGAGGAATGCGTTGGCAAACACTGGTCTAAGAGGTTTTGAAGTGATTGAGGATGCAAAATCACAACTTGAGGCCAAATGTCCAGGTGTTGTTTCTTGCGCCGACATCCTGG
CATTGGCAGCACGTGATGCTGTGGACTTG
GTACTAAATATAATAATAATGTTTAGTTCCACCCTTAAACACACACTAACATGGACATATTCTCATTATCACTCCTTTTTTATGATTTATC
TGAACTATCACTTTAATTCTTTAATTTTTATGGTTTGAAAATGTCATTCACTTTATTCCTTAATATTATATACAACTAACATNNNNNNNNNNNNNNNNNNNNNNNNNATGTGTACTGATA
GTTTTATAATATCAATCAATTAAAAATGATGATTGATGTAATTTTTTAAAGTTGTTATGATAAAAGTTAACAAACTATGGTTAGTAATTAGATGCTGATAATATAAAATTAACTTACATG
TAACCTATTTTTTCTTTAAATAGAATTTAATGATTATATACTAATGGCATAACATTGTTTTACCCTACCAACACATACAATATCTTGCACCATGTAAGAGTTTTATTCATGATTTATTAA
TGCTTCATTCGATAAAAGTAACACTTAACATAAATGGCAGAGTGATGGTCCAAGTTGGTCAGTACCTACTGGAAGAAGAGATGGGAGGGTTTCTTTATCCTCTCAGGCCTCAAACTTGCC
TTCTCCACTTGACTCTATTTCTGTCCAAAGGAAAAAATTTGCTGACAAAGGCATGGATGACCACGACCTTGTCACCTTAGTTG
GTGTGTTTTCTTTCGCATTATTACATTTCTATGGGAT
TCATAATTGATGTAAAAATTTTACTGTTATTAATAATAATAATTTATATGATAAGTTTGTTAACTTTAAAGTAATTTAAAAGATAATTTATAATTGGATTACACTACATAAACATTAAAC
CCTTCATAATTATGCTACCATTATATGGTCTACAAAAAAGTTATTAATGTGCTACTTTATTGTCTGTCTGCAGGGGCACACACCATAGGCCAAACAGAATGCAGATTCTTCAGTTACCGC
TTATATAATTTCACCACCACTGGCAATTCAGATCCAACCATAGACCAAAACTTCTTAGGCCAACTTAAAACCCTGTGTCCCAATATAGGAGATGGCTTGAGAAGGGTATCTTTGGACAAA
GATAGTCCAGCCAAATTTGATGTTAGTTTCTTCAAAAATGTACGTGATGGTAATGCGGTTCTAGAGTCAGACCAAAGGCTGTGGGGAGACTCTAATACACAAAGCATAGTGCAGAGTTAC
GCTGGGAATATAAGAGGGTTATTGGGGATTAGATTTGATTATGAATTTCGAAAGGCTATGGTTAAATTGGGTGGTGTAGAGGTAAAGACCGGTTCACAAGGAGAGATTAGAAAGGTGTGC
TCAAAAGTTAATAGATAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACACACATGGTTGGGTTCATTAGTGATTTTTATGACAATTTCGGCCGTACAAGCCCAACTCAAAACTGGGTTTTACTCCTCTTCGTGCCCAAACGCAGAAGCCACAGTTCGATCC
ACTGTTGAATCCTACTTCAATAAAGATCCTACAATTGCTCCTGGCCTGCTCCGACTTCATTTCCATGATTGCTTTGTCGAG
GGCTGCGATGGTTCAGTTTTGATTTCAGGCTCTTCTGCG
GAGAGGAATGCGTTGGCAAACACTGGTCTAAGAGGTTTTGAAGTGATTGAGGATGCAAAATCACAACTTGAGGCCAAATGTCCAGGTGTTGTTTCTTGCGCCGACATCCTGGCATTGGCA
GCACGTGATGCTGTGGACTTG
AGTGATGGTCCAAGTTGGTCAGTACCTACTGGAAGAAGAGATGGGAGGGTTTCTTTATCCTCTCAGGCCTCAAACTTGCCTTCTCCACTTGACTCTATT
TCTGTCCAAAGGAAAAAATTTGCTGACAAAGGCATGGATGACCACGACCTTGTCACCTTAGTTG
GGGCACACACCATAGGCCAAACAGAATGCAGATTCTTCAGTTACCGCTTATATAAT
TTCACCACCACTGGCAATTCAGATCCAACCATAGACCAAAACTTCTTAGGCCAACTTAAAACCCTGTGTCCCAATATAGGAGATGGCTTGAGAAGGGTATCTTTGGACAAAGATAGTCCA
GCCAAATTTGATGTTAGTTTCTTCAAAAATGTACGTGATGGTAATGCGGTTCTAGAGTCAGACCAAAGGCTGTGGGGAGACTCTAATACACAAAGCATAGTGCAGAGTTACGCTGGGAAT
ATAAGAGGGTTATTGGGGATTAGATTTGATTATGAATTTCGAAAGGCTATGGTTAAATTGGGTGGTGTAGAGGTAAAGACCGGTTCACAAGGAGAGATTAGAAAGGTGTGCTCAAAAGTT
AATAGATAT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGATCAAGGG GAAGTGAAGT AGCAAATACC AAGTTGTTTC AAGTTAAGCC TTATTACAGT TAGTACCAAA TATGGGACAC ACATGGTTGG GTTCATTAGT GATTTTTATG ACAATTTCGG  CCGTACAAGC CCAACTCAAA ACTGGGTTTT ACTCCTCTTC GTGCCCAAAC GCAGAAGCCA CAGTTCGATC CACTGTTGAA TCCTACTTCA ATAAAGATCC TACAATTGCT CCTGGCCTGC  TCCGACTTCA TTTCCATGAT TGCTTTGTCG AGGGCTGCGA TGGTTCAGTT TTGATTTCAG GCTCTTCTGC GGAGAGGAAT GCGTTGGCAA ACACTGGTCT AAGAGGTTTT GAAGTGATTG  AGGATGCAAA ATCACAACTT GAGGCCAAAT GTCCAGGTGT TGTTTCTTGC GCCGACATCC TGGCATTGGC AGCACGTGAT GCTGTGGACT TGAGTGATGG TCCAAGTTGG TCAGTACCTA  CTGGAAGAAG AGATGGGAGG GTTTCTTTAT CCTCTCAGGC CTCAAACTTG CCTTCTCCAC TTGACTCTAT TTCTGTCCAA AGGAAAAAAT TTGCTGACAA AGGCATGGAT GACCACGACC  TTGTCACCTT AGTTGGGGCA CACACCATAG GCCAAACAGA ATGCAGATTC TTCAGTTACC GCTTATATAA TTTCACCACC ACTGGCAATT CAGATCCAAC CATAGACCAA AACTTCTTAG  GCCAACTTAA AACCCTGTGT CCCAATATAG GAGATGGCTT GAGAAGGGTA TCTTTGGACA AAGATAGTCC AGCCAAATTT GATGTTAGTT TCTTCAAAAA TGTACGTGAT GGTAATGCGG  TTCTAGAGTC AGACCAAAGG CTGTGGGGAG ACTCTAATAC ACAAAGCATA GTGCAGAGTT ACGCTGGGAA TATAAGAGGG TTATTGGGGA TTAGATTTGA TTATGAATTT CGAAAGGCTA  TGGTTAAATT GGGTGGTGTA GAGGTAAAGA CCGGTTCACA AGGAGAGATT AGAAAGGTGT GCTCAAAAGT TAATAGATAT TAAGCAATTA AGAGTGGGTT AGTATTTAGC TTGTAATTTA 
TCAATAATCC TTGACATAAG TGATAATGAC TTATGTCTTT TAATCAAGCG GTCCATAATT TAAATTATGA TTGATCCATA AGTAT 

Retrieve as FASTA